During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
 
        
             
        
        
        
A) Discuss the anatomical changes that occurred in the bipedal hominin
The changes that occurred are the loss of the capability in hands to grasp on branches. This is because of the presence of an opposable thumb. Another change is the loss of walking on 4 legs. The hominids started to have an upright posture, have long legs and walk on their two feet.
b) How they reflect habitat adaptation
The species lived in wooded areas like forests. This is why they required the grasping abilities on their feet and hands to be able to move in the trees while holding branches. Shifting to unwooded areas like the grasslands made them lose some of their abilities. This is because they were no longer needed.
c) Discuss the hypothesis that propose why the change occurred.I
It was necessary for change to occur due to the fact that forests were becoming fragmented and patchy. Food also became dispersed and scarce. This made the species use more energy to get food and also have free hands for them to be able to pick up food. They also gained an upright posture.
d) How can 3D scans and printing be applied to other areas of science.
3D scanning has been used to scan many objects from different museums. It has also been used to identify the age of fosils and artifacts. 3D printing can be used to create prototypes in scientific technology research. It is also used to analyse features of objects.
e) What applications can they have
3D scanning and printing has been applied in architectural surveys to provide accurate measurements increasing on productivity and saving on time. It has also been used in health to create a detailed study of body parts and produce comfortable prosthetic limb for patients.
        
             
        
        
        
Answer:
I would think C, if it is consistent then the results should be reliable!
Explanation:
 
        
             
        
        
        
Making rough estimate of physical quantities is useful because it allow us to have an idea of how big or small a quantity is, it gives us the near result of the real quantity a matter contains. The approximate quantity obtained will give us information about the size of the quantity.
        
             
        
        
        
Answer:
Read Exp:
Explanation:
1st one - Attracts Pollinators. 
2nd one -  Prevents water loss.
3rd one - Traps insects.