1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snowcat [4.5K]
3 years ago
12

Decomposers use a process know as ?

Biology
2 answers:
Sophie [7]3 years ago
3 0
They use the process known as decomposition- much like the name!
Airida [17]3 years ago
3 0

Answer:

Decomposition

Explanation:

Decomposers include bacteria and fungi. These organisms carry out the process of decomposition, which all living organisms undergo after death. Decomposition is an important process because it allows organic material to be recycled in an ecosystem.

You might be interested in
Carbon dioxide emissions cause ocean acidification. Ocean acidification reduces coral growth. If ocean acidification continues,
Katena32 [7]

Answer:

B) environmental risk

Explanation:

got it right on edge

5 0
2 years ago
What makes a molecule a carbohydrate?
Lynna [10]
A molecule is a carbohydrate if it contains carbon and water
3 0
3 years ago
Read 2 more answers
Which is the best description for why skeletal muscle stores glycogen
gayaneshka [121]

Answer: Skeletal muscle is a heavy consumer of energy.

3 0
3 years ago
Which molecules may diffuse across a cell membrane without the expenditure of energy or the use of membrane proteins?
wel

Explanation:

In simple diffusion, small molecules without charges such as oxygen and carbon dioxide flow through a plasma membrane without assistance and without expending energy. Other substances such as proteins, glucose and charged particles called ions cannot pass through the selectively permeable membrane

6 0
3 years ago
Answer for number 9. <br> Helllp
BARSIC [14]
<span>Aristotle would have trouble classifying euglena since Aristotle's classification system was only for plants and animals. Euglena exhibited characteristics of photosynthesis which is present in plants and movement which is only present in animals. </span>
6 0
3 years ago
Other questions:
  • a car has a mass of 1,200 kg. what is its acceleration when the engine exerts a force of 600 n? (formula: f=ma)
    6·2 answers
  • A student designs an experiment to test substances X, Y, and Z, to determine which one is a catalyst for the reaction: A + B ® C
    12·1 answer
  • Cell 1<br> Cell 2<br> Cell 2 is aln) cell<br> prokaryote<br> plant<br> bacteria<br> animal
    6·1 answer
  • Are blue stars young or old how can you tell
    10·1 answer
  • 5. The positive side of the battery will have a ______
    9·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • When making bread, yeast, flour, sugar, and water are mixed together and set in a warm area to rise. A student cut the rising do
    6·1 answer
  • How could farmers increase the yields of their crops without using
    7·1 answer
  • The cell membrane is a unique structure that has many functions.
    10·1 answer
  • Traits are passed from parents to offspring. These traits are determined by
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!