1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksandrR [38]
3 years ago
14

Please help due in like 10 mins help asap willgive brianlesytonly part 2

Biology
1 answer:
Brut [27]3 years ago
6 0

Answer: I cant see what you are asking next time use something other than pdf instead use png

Explanation:

You might be interested in
What correction needs to be made to the information on the table
Vedmedyk [2.9K]

Answer:

Igneous rocks are the cooling and hardening of magma or lava and sedimentary rock is made of sediment cemented together

Explanation:

The three types of rock are igneous, metamorphic and sedimentary. Igneous rock is formed by the cooling and hardening of magma and lava. Examples include granite and basalt. Metamorphic rock is formed when other rocks are exposed to high heat and pressure, causing a chemical change in the rock. Examples include marble and gneiss. Sedimentary rock is formed when sediment is cemented together by minerals. Examples include sandstone and limestone.

Hope this Helps! ::)

3 0
3 years ago
19. A cell is ready to break down pyruvate
iVinArrow [24]

Answer:

The correct option is C. The cell followed Kreb's pathway.

Explanation:

Krebs cycle can be described as a metabolic pathway for the release of energy during the process of aerobic respiration. The Kreb's cycle constitutes a series of oxidation reactions through which pyruvate is converted into carbon dioxide. About 15 moles of ATP is released as a result of Kreb's cycle. The reactions of the Kreb's cycle take place mostly in the mitochondria. The Kreb's cycle is commonly named as the Citric Acid Cycle.

3 0
3 years ago
A plant's response to the position of the sun in the sky is termed
Stels [109]
Answer is B. Heliotropism
4 0
3 years ago
Read 2 more answers
Solar energy does not warm Earth's surface evenly. For example, during the day, land areas warm up faster than nearby bodies of
Nadya [2.5K]

Explanation:

The uneven warming of the earth surface causes land and sea breeze over the land and water.

Water has a very high specific capacity and it takes more heat to cause a fractional increase in its temperature. During day, the air around water is cold and dense and under high pressure.

The land adjacent to the water, is a better conduct with a low specific heat capacity. When warming of the earth starts by the sun, the air on land heated by heat radiated from the surface. Air on land is warm, less dense and light.

This forces the air on land to move seaward and the cold air from the sea to move land ward and a sea breeze is set up.

At night the reverse is the case. The land loses heat very fast and the air around it is cold and dense. The water body does not lose heat so fast and the air around is warm and lighter. Air from the land replaces that on the surface of water and a land breeze is set up

learn more:

Heat transfer from the sun brainly.com/question/1140127

#learnwithBrainly

6 0
3 years ago
When a female cow with black hair is crossed with a bull with white hair, the offspring are known as blue roans because of their
Hoochie [10]

Answer:

2) codominance

Explanation:

CODOMINANCE is a non-mendelian pattern of inheritance which occurs when the alleles of a particular gene is neither dominant nor recessive over its contrasting allele, hence, they are both expressed in the resulting hybrid when they combine. The two alleles are said to be CODOMINANT.

This is the case in this question involving a gene coding for hair color in cattle. The allele for black hair is codominant with the allele for white hair, hence, they combine to form an hybrid with both colors expressed (black and white) called blue roan.

According to the attached image, the heterozygous genotype in the offspring exhibits a phenotypic expression of both traits under CODOMINANCE inheritance pattern.

3 0
3 years ago
Other questions:
  • In terms of topography, the deepest soils are ________
    6·1 answer
  • Why can't HIV be transmitted through air?
    14·1 answer
  • What is the difference between circulatory system and types of circulation
    12·1 answer
  • 2 Points
    8·1 answer
  • A person whose blood tests show neither protein A nor protein B present has blood type: 1.O 2.A 3. AB URGENTTTTTTT IN A QUIZ
    15·1 answer
  • How is soil made better for plants by biological decomposition?​
    8·1 answer
  • A study was conducted in a nursing home to examine the association of hand-washing and Gastroenteritis. Residents with the disea
    8·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • What organelles are used in passive and active transport
    8·1 answer
  • Consider the functions of the kidney in the urinary system and the blood vessels in the circulatory system. what tissue type is
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!