1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Archy [21]
3 years ago
8

Members of different species do not produce offspring due to:

Biology
2 answers:
exis [7]3 years ago
6 0

Answer:

Broadly speaking, different species are unable to interbreed and produce healthy, fertile offspring due to barriers called mechanisms of reproductive isolation. These barriers can be split into two categories based on when they act: prezygotic and postzygotic.

Explanation:

So the answer would most likely be C.

-Eijiro <3

frozen [14]3 years ago
5 0
A is the answer. I believe, although I’m not 100% sure
You might be interested in
Which scientific force is primarily responsible for maintaining control of your vehicle?
vfiekz [6]

Answer:

Inertia

Explanation:

This force ensures that objects remain in one course with less tendency to change direction when in motion or at rest. This force is the reason why you can let free the wheel of a car in motion and the car will more or less maintain course without toppling over. It is this same force that ensures that greater energy is required to launch the car from complete stall to motion.  

4 0
3 years ago
Do you know you're a genius because you can convert oxygen into Carbodioxide ~ <br><br>​
alex41 [277]

Answer:

The lungs and respiratory system allow us to breathe. They bring oxygen into our bodies (called inspiration, or inhalation) and send carbon dioxide out (called expiration, or exhalation). This exchange of oxygen and carbon dioxide is called respiration.

Explanation:

yeah , you're right

we are genius.......

lol are too smart genius

6 0
2 years ago
A particular star is orange. Another star that is much cooler is expected to be. red white blue green
algol [13]
A star's color often times determines the temperature of it. In this case, red would be the coolest color (and would be cooler than orange). 
3 0
3 years ago
Read 2 more answers
Why do some birds have bright colors whole others look more camouflaged?
Nuetrik [128]
Evolution, allowed birds to survive in various climates
4 0
3 years ago
Why does the cell go through elaborate process to convert glucose into carbon dioxide and water?
Tems11 [23]
Cellular<span> Respiration. </span>Cellular<span> respiration is the </span>process<span> of oxidizing food molecules, like </span>glucose<span>, to </span>carbon dioxide and water<span>. The energy released is trapped in the form of ATP for use by all the energy-consuming activities of the </span>cell<span>.

</span>
4 0
3 years ago
Other questions:
  • As a result of the industrial revolution _____.
    15·2 answers
  • How is the speed of a rivers flow determined??????
    5·1 answer
  • The process of creating several different species from one ancestral species is called _____________________ ___________________
    11·2 answers
  • What are transitions metals
    9·2 answers
  • What one of the following items is a producer of pollution?
    10·2 answers
  • In mitosis, the results are 2 different haploid cells.<br> ASAP please!!!
    7·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Why do daughter cells have DNA that is identical to the parent cell? Explain your answer.
    15·1 answer
  • Can someone please answer these two questions correctly? thank you so much!! ((:
    9·1 answer
  • What is a benefit of using a model? (fpoint)
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!