1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew11 [14]
3 years ago
5

Una persona hala un trineo a lo largo de un espacio horizontal de 9 m la cuerda con que sa hala forma un ángulo de 60° con la ho

rizontal y la fuerza para mover el trineo es de 125 N a. Calcular el trabajo realizado por la persona al halar el trineo
Biology
1 answer:
polet [3.4K]3 years ago
5 0

Answer:

978,75 Newton metro.

Explicación:

El trabajo realizado es de 978,75 Newton metro cuando la fuerza es de 125 newton, la distancia es de 9 metros y el ángulo es de 60 grados porque cuando usamos la fórmula del trabajo realizado obtenemos esta respuesta. La fórmula del trabajo es fuerza x desplazamiento x Sin (θ). θ muestra la dirección y el ángulo en el que se realiza la fuerza. Entonces, multiplicando todos estos valores obtenemos la respuesta para el trabajo realizado, que es 978,75 Newton metro.

You might be interested in
Autopsy conducted on an individual who had died of pneumonia revealed bluish-green pus filling the lung. The causative agent of
Rus_ich [418]

Answer:

The agent causing the pneumonia, where bluish-green pus was found, is most likely Pseudomonas aeruginosa.

Explanation:

Pseudomona aeuriginosa is a gram-negative bacteria that is one of the main causes of hospital-acquired infections, including pneumonias in mechanically ventilated patients.

One of the characteristics of P. aeuriginosa is the formation of a bluish-green pus, since it has the capacity to form cyanide-based blue pigment upon contact with the organic tissues it infects. This is the reason why previously P. aeruginosa was called a pyocyanic bacillus.

<em>     The other options are not correct because the only bacterium that produces blue-green pus is P. aeruginosa.</em>

7 0
3 years ago
I really need help!!!
GrogVix [38]

Answer:

the correct answer is        that it is compacting down due to very little water being in the aquifers

Explanation:

because subsiding means going down

4 0
3 years ago
Explain what would happen to an animal if the vegetation around them disappeared​
velikii [3]

Almost all living creatures on our planet depend on plants for food and oxygen, either directly or indirectly. So, if all the plants disappeared, eventually so would almost all the other life. Also, Earth would be hotter.

6 0
3 years ago
1. Do you think the density of the ice affected the melting rate of the ice, or do you think adding the objects affected the mel
defon
The density of ice does not affect its melting rate because there is more to melt in the same size but adding objects will affect the melting rates because there is less to melt
6 0
4 years ago
Read 2 more answers
Which plane divides the body into left and right portions?
galina1969 [7]

The plane that divides the body into left and right portions is known as the sagittal plane also known as the median plane. Sagittal plane bisects the body into two halves and the plane motion occurs around a coronal axis. Movements in the sagittal plane are the flexion and the extension. The Flexion movement involves the bending movement in which the relative angle between two adjacent segments decreases. The Extension movement involves a straightening movement in which the relative angle between the two adjacent segments increases. In general, both flexion and extension movement occur in many joints in the body, which include shoulder, wrist, vertebral, elbow, knee, foot, hand and hip.

The sagittal plane has two subsections; they are the Midsagittal and the Parasagittal. The midsagittal runs through the median plane and divides along the line of symmetry while the parasagittal plane is parallel to the mid-line and divides the body into two unequal halves.



3 0
4 years ago
Other questions:
  • What is combustion and how does it affect the carbon cycle
    11·1 answer
  • The concept of natural selection is a mechanism of evolution where environmental pressures select for phenotypes that exist in p
    14·2 answers
  • Which chemical bond most likely stores the most energy
    15·2 answers
  • What is an example of competition among members of a meerkat population?
    15·1 answer
  • The cell membrane is also called what
    7·2 answers
  • Suppose in a species of petunia, both locus A and locus B can independently determine petal color. At locus A, pink (A) is domin
    10·1 answer
  • Which of the following is an important property of water
    7·2 answers
  • Which process makes it possible for all the major organs of the body to be formed by week 10 of human development?
    8·1 answer
  • Jon lives near a toy factory. He is regularly exposed to foul smells because the factory makes excessive use of plastic as a raw
    7·3 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!