1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Doss [256]
3 years ago
13

How is ammonia produced by bacteria in the soil

Biology
1 answer:
aivan3 [116]3 years ago
4 0
The Haber process converts nitrogen gas into ammonia<span> used in fertilizers. </span>Ammonia<span>is converted to nitrates by nitrifying </span>bacteria in the soil<span>. Plants absorb nitrates from the </span>soil<span> and use these to build up proteins. The plant may be eaten by an animal, and its biomass used to </span>produce<span> animal protein.</span>
You might be interested in
Which of these brain structures is believed to play a role in judging whether external stimuli offers threats or rewards?
dexar [7]
The answer to this is amygdala
5 0
3 years ago
Read 2 more answers
A chemical has been found to harm the same compound in both prokaryotic and eukaryotic cells. Which compounds are those?
Mashcka [7]
I would have to say A. ribosomes are known to break and release their digestive juices into the cell upon cell death. thus killing them
5 0
3 years ago
How many glucose molecules can be formed by 6 molecules of carbon
Hoochie [10]

Answer:

1

Explanation:

"Six carbon dioxide molecules (CO2) are required to create one glucose molecule (C6H12O6) because carbon dioxide has one carbon per molecule, while glucose molecules have six carbons."

3 0
3 years ago
Someone please answer
Margarita [4]

Answer:

out of the cell

bc water goes towards salt

4 0
3 years ago
Two major types of protein secondary structures are referred to as.
UNO [17]

Answer:

α helix and β sheet / alpha helices and beta sheets

Explanation:

8 0
2 years ago
Other questions:
  • Even-aged management practices involves clearing trees that _______.
    7·2 answers
  • LD50 is used to express _____.
    10·2 answers
  • The atoms, molecules, or compounds formed in the reaction. Which part of a chemical reaction does this define?
    13·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What is one difference between dna and rna?
    13·1 answer
  • 1. The number of individuals that can be found per unit area.
    13·1 answer
  • Suppose a storm produced precipitation in the form of ice particles. What type of precipitation would this be? Why?
    11·1 answer
  • Why do we cook the traditional Chinese dish "pork knuckles and ginger stew" in a clay pot rather than a metal pot?
    8·1 answer
  • Please help me!!!! 40 points
    5·2 answers
  • I have this segment of DNA for one strand: 5' ATGCATTGA3'. Predict the sequence of the next strand.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!