1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Goshia [24]
3 years ago
12

Describe and explain the difference beetween the rights and left ventricle

Biology
1 answer:
Llana [10]3 years ago
6 0

Answer:

Explanation:

The right ventricle gets the deoxygenated blood(from right atrium) and pumps blood into the pulmonary artery. The left ventricle gets oxygen rich blood(from left atrium)and pumps it through the aorta.

You might be interested in
Which type of cell DOES have membrane-bound organelles?<br> A. eukaryotic<br><br> B. prokaryotic
Vlad1618 [11]
A. Eukaryotic because Ik Im right
7 0
3 years ago
Read 2 more answers
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
Reika [66]

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

3 0
4 years ago
Name two pathogenic bacteria from each of the oxygen requirement groupings, their gram stain reaction and the diseases they caus
solniwko [45]
Meningitis
Gonorrhea
3 0
3 years ago
The law of segregation is the law which states that two factors controlling a characteristic separate and go to different
NeTakaya

Answer:

true

Explanation:

6 0
3 years ago
Read 2 more answers
Three parts of an amino acid
Nadusha1986 [10]

Answer: a basic amino group (−NH2), an acidic carboxyl group (−COOH), and an organic R group (or side chain)

Explanation:

5 0
3 years ago
Other questions:
  • What does not involve the use of force or illegal entry in order for property to be taken? Robbery Burglary Larceny All of the a
    15·2 answers
  • Which of the following personal health practices should a person follow to prevent heart diseases?
    8·1 answer
  • Nutrition topics dominate the media. How do you determine whether a nutritional claim or product is too good to be true? What ty
    12·2 answers
  • Which statement describes the concept of uniformitarianism?
    10·1 answer
  • A student examining leaf cross sections under a microscope finds many loosely packed cells with relatively thin cell walls. The
    9·1 answer
  • The moon is an example of a _________ object while a lit match is an example of a _______object.​
    7·1 answer
  • Which of the following describes the purpose of the human genome project?
    10·1 answer
  • A sparrow will build its nest under the nest of an osprey. The smaller birds get protection because other predators will not mes
    10·2 answers
  • Help ill never be done with school if i dont do this
    12·1 answer
  • What are the effects of the even on each of the Earth's four spheres?​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!