1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
3 years ago
10

Temperature is a measure of?

Biology
2 answers:
puteri [66]3 years ago
5 0

Answer:

kinetic energy

Explanation:

i saw this somewhere before

Vsevolod [243]3 years ago
3 0

Answer:

its heat

Explanation:

You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Helppppppppppppppp lls
xeze [42]
Answer is A. arranged in regular, repeating patterns
4 0
3 years ago
Which of the following adaptions allowed plants to transport water and nutrients from the soil to all of the cells within the pl
Ksenya-84 [330]

Answer:

c

Explanation:

I took the test

3 0
3 years ago
Read 2 more answers
Which discovery is attributed to Phoebus Levene?
KatRina [158]

Answer options:

  • extraction and observation of DNA
  • identification of ribose and deoxyribose
  • recognition of RNA as DNA’s messenger
  • construction of an accurate DNA model

Answer:

  • identification of ribose and deoxyribose

Explanation:

Phoebus Levene was an American biochemist who studied the structure of DNA and RNA. He was able to isolate the sugars (ribose and deoxyribose) from the nucleic acids, which are an important part of their structure.

He also determined how the nucleic acid components combine to form the nucleotides, the basic building blocks of nucleic acids, and how the nucleotides combine in chains to form the polymer.

7 0
3 years ago
Read 2 more answers
T is a trait for tallness in pea plants. the trait for shortness is t. in a case of simple dominance, what is the height of a pl
Elza [17]
The phenotype will show dominance over shortness.. The plant will be tall
the cases:
Tt = tall
TT= tall
tT= tall
tt = short
8 0
3 years ago
Read 2 more answers
Other questions:
  • True or false? The poles receive 24 hours of sunlight a day during summer, and zero hours of sunlight during the winter.
    10·2 answers
  • In the cells of some organisms, mitosis occurs without cytokinesis. this results in ________.
    15·1 answer
  • Polygenic means that most traits are controlled by ________.
    6·1 answer
  • Which process is a form of mechanical weathering?
    5·2 answers
  • This abiotic factor in the photograph characterizes which biome?
    7·1 answer
  • Which of the following is not an example of response to stimulus.1) watering in the mouth when we see delicious food item
    11·2 answers
  • Explain the importance of decomposrs to the overall biogechemical cycle
    11·1 answer
  • How does water clarity effect sea life
    11·1 answer
  • An unidentified organism that makes its own food and whose cells have a cell wall and a nucleus would be a member of which domai
    9·1 answer
  • Nce - SC3206 - T4L
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!