1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harman [31]
3 years ago
14

What process does a multi-cellular organism use to replace its damaged body cells

Biology
2 answers:
Zolol [24]3 years ago
5 0

Answer: mitosis.

Explanation:

zheka24 [161]3 years ago
5 0
The process is called mitosis.
You might be interested in
If a population is in Hardy- Weinberg equilibrium, what is happening to that population? A. It is experiencing a shift in popula
Trava [24]
I would say B because the population is not experiencing any genetic mutations and no genetic mutations is a cause of Hardy- Weinberg equilibrium. Hope that helps!
7 0
2 years ago
What shape will a be ?
MatroZZZ [7]

Answer:

Some cells, such as erythrocytes, will actually burst as water enters them by osmotic flow. Rupture of the plasma membrane by a flow of water into the cytosol is termed osmotic lysis.

6 0
3 years ago
Nephrons are the functional cells of the urinary system. They take in blood, metabolize nutrients, and help filter out waste pro
Andrews [41]

Answer:

Kidney

Explanation:

Nephron is the basic unit of structure in the kidney

3 0
3 years ago
Read 2 more answers
Como podemos trasladar una caja de 50 kg desde planta baja hata un primer piso que presenta una inclinacion de 40º que tipo de m
avanturin [10]

Answer:

Explanation:

We can easily move the box from a ground floor though to the first floor at an angle of 40° to the horizontal by simply pushing the load through an inclined plane. We will simply be lean the inclined plane on the building at the required angle and the push through the the height of the building.

Based on the explanation above, the best type of simple machine to use is an INCLINED PLANE. <em>Note that the essence of using a machine is simply to make our work easier and faster and also be able to overcome a much larger load with a minimal effort. </em>

4 0
3 years ago
Phosphorus does not exist where?
svetoff [14.1K]
I think that it is atmosphere but not 100% sure you might want to double check
8 0
3 years ago
Other questions:
  • What does this passage most likely reveal about how the characters view the situation?
    6·2 answers
  • Catastrophism, meaning the regular occurrence of geological or meteorological disturbances (catastrophes), was Cuvierʹs attempt
    9·1 answer
  • The chemical reactions of the ___ occur in the grana
    5·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Frozen water (ice) has less density than liquid water.
    10·1 answer
  • Will try to give brainliest PLEASE HELP ASAP
    10·2 answers
  • Grapes growing on a vine are observed to shrink slightly during the day and increase in size at night. This is because:
    12·1 answer
  • What four type of animals
    12·1 answer
  • ito ay tamang paggamit ng tamang bantas sa pagsulat ng isang suring pelikula upang maging epektibo ang pagsulat​
    10·1 answer
  • In the life cycle of zygomycota fungi, the filamentous, asexually reproducing forms visible to the human eye are called:
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!