1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
2 years ago
8

What is a possible reason for extinction?

Biology
1 answer:
Taya2010 [7]2 years ago
7 0

Answer:

The number of habitats falls below a critical level.

Explanation:

The possible reason for extinction is that the number of habitats falls below a critical level. This makes it impossible for organisms to survive.

  • A habitat is the dwelling place of living organism in an ecosystem.
  • The resources and other materials that ensures the survival of an organism are made available in the habitat.
  • When a habitat begins to thin out and can no longer support organisms, then extinction will ensue.  
You might be interested in
Describe how stem cells have the potential to treat sick people. ( in scientific words please).
Assoli18 [71]

Stem cells are undifferentiated cells that have the ability to differentiate into any kind of body cells like muscle, skin, heart etc.

There is alot of research being conducted on the stem cells because they have the potential to treat almost any kind of disease. This is because they are embryonic cells that can be specialized into a person's any type of body cells. When stem cells are specialized into the any kind of body's cells like cardiac, muscular, they can repair all the damaged cells and replace them with the new and healthy cells.

Currently, they are being used to repair:

  • Nerve cells that are damaged due to some injuries like stroke, spinal injury,  Parkinson’s disease, Alzheimer's and other such neurological disorders.
  • They can repair insulin producing cells so millions of people can be treated against diabetes and other problems that arise due to diabetes like kidney and cardiac issues.
  • They have the ability to repair almost any kind of injured tissue.
  • They can provide clues of muscle re-pairment like how organs are repaired after an injury, trauma or problem like heart attack.
  • Stems cells can be used to make new drugs and minimize the side effect of the drugs.
  • This is a fascinating area of science that has the potential to repair any damaged organ of human without getting it replaced by a new one.

Hope it help!


3 0
3 years ago
Is it true that ocean biomes contain a wider biodiversity than land biomes why or why not?
EastWind [94]
The difficulty with this answer, lies in the fact that not all of land and ocean biomes have been completely explored. The ocean is vast, covering approximately 70% of the Earth's surface, with literally vertical miles or kilometers of depth, and with some areas with sparse to no biodiversity. The same can be said about certain areas of large deserts with very low levels of biodversity, void of life, like vast deserts of the Sahara or Gobi. But, the Amazon rain forest contains still unknown species of plant and animal life, just like the ocean. Because of its vastness, intellectually, I would say  the ocean contains more biodiversity, but the answer is scientifically, as of now, yet to be proven one way or the other.
3 0
3 years ago
Which best describes the process of editing a conclusion?
dedylja [7]
Brainstorm, draft, reread, revise, edit, final draft.
Conclusions should have a hook, bridge, and call to action and/or summary.
3 0
3 years ago
Earth's outer core is made of_____.
inn [45]

Answer:

Liquid metal.

Tell me if wrong. :) Hope it helps!

Explanation:

7 0
2 years ago
Read 2 more answers
Which compounds present in insects are composed of the amino acids that provide the Venus flytrap and sundew with much of their
Fudgin [204]
I believe it is Protein
3 0
2 years ago
Other questions:
  • 5. What is a Blue Moon?
    12·1 answer
  • Which of the following is a divergent boundary?
    11·1 answer
  • Consider the motion diagram. It illustrates a car's velocity (V) and acceleration (A). The BEST description of a car’s velocity
    13·1 answer
  • Reactions within ________ provide most of the energy needed by a typical cell.
    14·1 answer
  • Reread the first paragraph of the introduction. Describe the types of stimuli your body is reacting to as well as the decisions
    15·1 answer
  • Where does fertilization take place in the moss life cycle?
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • 5. Choose the phrases that would make the completed statement TRUE: "Cells will NOT divide if....
    8·1 answer
  • Scientists say that conditions must be "just right" for a hurricane to start up. Which is the first step of "just right" in the
    9·1 answer
  • The odds of expected outcomes of a physical characteristic in a particular breeding
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!