What happens to energy as it moves through the food chain/web?

2 answers:

8 0

A: As energy moves through trophic levels in an ecosystem the amount that is available decreases. Q: How does energy flow in a food web or food chain? A: Energy flows in a food web by being transferred to and between organisms as they undergo photosynthesis, are consumed by another organism, or decompose.

Elodia [21]3 years ago

5 0

Answer:

What happens to energy as it flows through the food chain and food webs of an ecosystem The chemical energy storied as nutrients in the bodies and wastes of organisms flows through ecosystems from one trophic level to the next and through this flow energy also is lost as heat.Explanation:

You might be interested in

Ling made a study chart for science class.

geniusboy [140]

Answer:

Explanation:

5 0

3 years ago

Read 2 more answers

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

IgorC [24]

Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations

5 0

3 years ago

Explain how the development and improvement of microscopes changed the study of living organisms.

nlexa [21]

Answer: As scientists started improving on the microscopes, the more they got to observe the cells in depth. Compound light microscope uses visible light to produce a magnified image and doesn't allow it to scatter.

3 0

3 years ago

The scientific name for humans in homo sapiens. what genus do humans belong to?

gulaghasi [49]

Homo.
The genus and species for humans is Homo sapiens, "Homo" being the genus, and "sapiens" being the species

4 0

3 years ago

Third, SNP array is considered as low to moderate costs of per sample, despite the significant decrease in costs associated with

Alenkasestr [34]

Development and Applications of a High Throughput Genotyping Tool for Polyploid Crops: Single Nucleotide Polymorphism (SNP) Array.

Polypoid species play significant roles in agriculture and food production. Many crop species are polyploid, such as potato, wheat, strawberry, and sugarcane.

Genotyping has been a daunting task for genetic studies of polyploid crops, which lags far behind the diploid crop species.

Single nucleotide polymorphism (SNP) array is considered to be one of, high-throughput, relatively cost-efficient and automated genotyping approaches.

However, there are significant challenges for SNP identification in complex, polyploid genomes, which has seriously slowed SNP discovery and array development in polyploid species.

Ploidy is a significant factor impacting SNP qualities and validation rates of SNP markers in SNP arrays, which has been proven to be a very important tool for genetic studies and molecular breeding.

This review presents a complete overview of SNP array development and applications in polypoid crops, which will benefit the research in molecular breeding and genetics of crops with complex genomes.

To learn more about Single Nucleotide Polymorphism: brainly.com/question/7882029

#SPJ4

3 0

1 year ago