1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Morgarella [4.7K]
2 years ago
7

Can someone help me out?

Biology
1 answer:
Usimov [2.4K]2 years ago
4 0

Answer:

Product

Explanation:

because you multiply two probability to get their probability together.

Hope this Helps!!

You might be interested in
GIVING 20 POINTS! Which is a goal of the Human Genome Project? to identify the 3 billion genes that comprise the human genome?
GrogVix [38]
The main goal of the human genome project is to identify the 3 billion genes that comprise the human genome. Hence the correct answer is option A.
8 0
3 years ago
Read 2 more answers
What could happen if negative feedback inhibition did not signal the pancreas to stop producing insulin and blood sugar levels d
SCORPION-xisa [38]

Answer:

If the pancreas did not stop producing insulin and blood sugar levels did not dropped to normal levels so it causes a disease called hyperinsulinemia. This disease causes heart disease and cancer in the body. With increased levels of insulin makes the cells resistant to harmone which means there is no effects of harmone on the cell and the body didn't perform its functions properly. The increase in insulin levels increase the absorption of sugar from the blood and the person gets more weight which is not good for health.

5 0
3 years ago
Describe the production and processing of a protein that that will be exported from a eukaryotic cell.
12345 [234]
Firts you begin with the separation of the messenger (RNA) from the (DNA) template and end with the release of the protein at the plasma membrane.

8 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
A process of change in a population through genetic variation over time​
vladimir2022 [97]

Answer:

Search Results

Featured snippet from the web

Evolution is a process that results in changes in the genetic material of a population over time. Evolution reflects the adaptations of organisms to their changing environments and can result in altered genes, novel traits, and new species.

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • ) what is the probability a knee injury resulted from a sport (contact or noncontact)?
    9·1 answer
  • Where do most phosphates and nitrates in the Chesapeake Bay come from?
    11·2 answers
  • Which of the following categories includes the most distantly related organisms?
    9·2 answers
  • What can be said about prokaryotes and eukaroytes
    6·2 answers
  • What impact do nuclear power plants have on water resources?
    5·1 answer
  • When multiple glaciers start their downward flow from a single point, the create a. A. Canyon
    14·2 answers
  • Explain the connection between the Nucleolus, ribosome, and RER.
    13·1 answer
  • Organización política del mundo
    14·1 answer
  • What is the probability that three F2 seeds chosen at random will include one green and two yellow seeds
    9·1 answer
  • The bed of a large pickup truck has a carrying capacity of 2. 5 cubic yards. How much is the capacity in cubic inches?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!