1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-14-01-66 [18.8K]
3 years ago
8

How autonomic nervous system does responds to social environment and engages in everyday human behavior? Support you answer with

research articles with references.
Biology
1 answer:
omeli [17]3 years ago
4 0
I’m not sure just need some points
You might be interested in
Select the correct answer. in which terrestrial biome would you find precipitation of 300 to 900 millimeters (mm) each year? a.
Jlenok [28]

In coniferous forests, the terrestrial biome receives precipitation of up to 300 to 900 millimeters (mm) each year.

Coniferous forests mainly consist of conifers and grow trees that produce thick needles and cones instead of growing flowers and leaves.

These are evergreen plants and stay green, healthy, and sustainable all year long.

In spite of flowers, these trees bear needles annually.

Moreover, conifers are very adaptive trees that can grow in very cold and dry climate zones.

It is due to their adaptability that they can survive all year long without losing a life.

Siberian fir, Dahurian, and Siberian larches are examples of confer forests.

If you need to learn more about conifer plants click here

brainly.com/question/2663607

#SPJ4

5 0
2 years ago
What is the hottest inner planet?
icang [17]
Mercury is the hottest inner planet.
6 0
3 years ago
Read 2 more answers
In landlocked lakes, water is discharged primarily through _____. precipitation evaporation groundwater seepage rivers and strea
zloy xaker [14]
The correct answer is evaporation. Hope this helps
4 0
3 years ago
Read 2 more answers
Which genotype determines that a person does NOT have sickle-cell anemia, but has the potential to pass the genetic disease on t
anyanavicka [17]

Answer:

<em>The correct option is C) AS</em>

Explanation:

Sickle cell anaemia is a recessive disorder in which the blood of the person is not able to clot properly. For sickle cell to occur, both the alleles for the trait have to be recessive. A person who has a dominant and a recessive allele will be heterozygous, showing the dominant characteristics. But such a person will be a carrier for the disease. There will be chances for the offsprings of that person to actually have the disease.

7 0
3 years ago
Plant seedlings with sunlight shining on them.
Julli [10]

Answer:

radiant energy to chemical energy

EXPLANATION:

sunlight is ntg but radiation, it falls on leaf and through the process of photosynthesis it converts radiant energy to chemical energy

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which sentence describes decomposers in a food chain
    6·1 answer
  • Muscles make up approximately __________ of a person's body weight.
    7·1 answer
  • What is the role of sensory neurons in the breakdown of food?
    15·2 answers
  • Can a steam cell taken from a baby, and giving the cell all that needs, can make clone
    6·1 answer
  • At the highest level, minerals are divided into_____and _____?
    13·1 answer
  • In the water cycle , when does water undergo a chemical change
    15·1 answer
  • the mississippi river carries tons of tiny rock fragments called sediments into the gulf of mexico. what do you think will happe
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following best describes a population?
    15·1 answer
  • If a woman with PKU is pregnant what are risks to the fetus?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!