Answer:
Heterogeneous mixtures are substances not mixed together.
Explanation:
I hope that is right
1.) is circulatory system. An easy way to remember this is, blood circulates throughout the body, CIRCULatory.
2.) Circulatory; resspiratory.
HOpe i could help and this got to you in time! :)
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Isolation after an Event. An earthquake causes two populations to become separate from each other. Over time, each species experiences genetic makeup specific only to their own smaller, less diverse populations. ... Over time, the group becomes an entirely different species.