1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lozanna [386]
2 years ago
9

What is the biodiversity score of farmland (maize)?

Biology
1 answer:
Karolina [17]2 years ago
7 0

Answer:

<h3><u>Required Answer</u><u>:</u><u>-</u></h3>

The intensification of agriculture has caused dramatic declines in farmland biodiversity (Carvalheiro et al., 2013; Senapathi et al., 2015). Since the 1990s, agricultural policies have been developed in Europe to mitigate this loss through agri-environmental schemes (AES). One AES is “sown wildflower strips”, the aim of which is to create new ecological infrastructures by sowing attractive wild flowers on arable land (a few % of the cultivated area). These ecological infrastructures fall within our definition of MIMS since they represent a massive introduction of managed species in the landscape.

You might be interested in
What do you call, mixtures with unsettled substances?​
solong [7]

Answer:

Heterogeneous mixtures are substances not mixed together.

Explanation:

I hope that is right

4 0
2 years ago
Please Answer The Question Below
Arte-miy333 [17]

1.) is circulatory system. An easy way to remember this is, blood circulates throughout the body, CIRCULatory.

2.) Circulatory; resspiratory.


HOpe i could help and this got to you in time! :)

3 0
3 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Where are enzymes found in the digestive system
PIT_PIT [208]
It is found in proteins.
7 0
3 years ago
Geographic isolation may result in​
joja [24]

Isolation after an Event. An earthquake causes two populations to become separate from each other. Over time, each species experiences genetic makeup specific only to their own smaller, less diverse populations. ... Over time, the group becomes an entirely different species.

5 0
3 years ago
Other questions:
  • Equilibrium seems to have occurred
    12·1 answer
  • Part 1: Use complete sentences to explain why coronal mass ejections occur.
    8·1 answer
  • Which sentence in the passage describes the benefits of sexual reproduction? During sexual reproduction, it’s important that the
    12·1 answer
  • A child is brought to the clinic by his mother. The mother states he has been at Boy Scout camp. The child has a rash on his fac
    10·1 answer
  • What part is the image shows a reproductive structure that forms offspring that are genetically distinct from its parents?
    8·2 answers
  • Two organisms, AABBCCDDEE and aabbccddee, are mated to produce an F1 that is self-fertilized to produce F2. If the capital lette
    11·1 answer
  • How does the immune system defend your body?
    14·1 answer
  • 6N right and 10N &amp; 2N left
    6·1 answer
  • PLEASE HELPPP DUE IN A FEW MINUTES
    10·1 answer
  • Emily has a maternal grandfather who is colorblind, which is an X-linked
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!