1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solniwko [45]
3 years ago
13

From the surface of the Earth to about __________ (9 miles) above the surface

Biology
1 answer:
UkoKoshka [18]3 years ago
5 0

ineed the  same questioon


You might be interested in
An example of chemical digestion is the breakdown of __________ into __________.
vodomira [7]
starch into glucose
proteins
into amino acids
lipids
into fatty acids

There are many more examples of chemical digestion which takes place in the body. Chemical digestion is the breaking of larger more complex molecules into smaller, simpler ones that can be taken up by the cells more easily and readily by the use of chemical agents.. Chemical digestion is carried out primarily using biological molecules called enzymes. For example, the breakdown of starch is done by an enzyme known as amylase, which is present in the saliva. 
7 0
3 years ago
Two students are comparing scientific experiments to investigations. They came up with the following ideas. Student A: Testing p
svet-max [94.6K]

Student A because it requires a hypothesis

8 0
3 years ago
Read 2 more answers
Once the DNA of a person has been copied it can be compared to the DNA of other people by using
Furkat [3]
D is the answer to this question hope it helps
4 0
3 years ago
Read 2 more answers
A woman with type A blood (whose father was type O) has children with a man that has type O blood. Both individuals are heterozy
Fantom [35]

Answer:

Explanation:

A woman with type A blood (whose father was type O) meaning her genotype is AO mates with

Man that has type O blood (OO genotype)

Both are heterozygous for MN blood group and both also heterozygous for the FUT1 gene controlling the synthesis of the H substance (Hh)- which determines the expression of the A and B antigen.

Cross

A O M N H h

O AO OO M MM MN H HH Hh

O AO OO N MN NN h Hh hh

Type A- 1/2 O-1/2 type M- 1/4 MN-1/2 N- 1/4, type H- 3/4 h-1/4

Type A with M antigen:

1/2*1/4*3/4 = 3/32

Type A with M and N antigens:

1/2*1/2*3/4 = 3/16

Type A with N antigen:

1/2*1/4*3/4 = 3/32

Type O with M antigen:

1/2*1/4*3/4= 3/32

Type O with M and N antigens:

1/2*1/2*3/4 = 3/16

Type O with N antigen:

1/2*1/4*3/4 = 3/32.

The 3/4 value comes from the expression of Hh-3/4 (this determines if the A and B Angie will be expressed).

8 0
3 years ago
Here's a question for you.
Verdich [7]

Answer:

If you have something like an endoscope except controlled remotely doctors and healthcare workers could in essence use it as a sort of reconnoissance tool for diagnosing injuries and illnesses.

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • Match the cell property descriptions with the correct organelle. Column A 1. Contains the genetic material (DNA): Contains the g
    11·1 answer
  • Yolanda retracted her foot when she stepped on a sharp object. She began examining her foot and the ground to identify the objec
    6·1 answer
  • The connection between producers and consumers is that only
    8·1 answer
  • What is unique about binge-eating disorder (bed) as compared to the eating disorders currently found in the dsm?
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Matter and energy move through ecosystems between different organisms, where does this matter come from and how does it travel t
    8·1 answer
  • Bradley is watching his twin daughters play on a playground seesaw, and is fascinated by the way only one side can be up or down
    5·1 answer
  • Explain in a paragraph how speed and velocity impact blood splatter<br><br><br> Please no links!
    8·1 answer
  • Energy plus matter is sufficient for continued development of order, complexity or growth.
    9·2 answers
  • You can see some blood vessels on the outside of the hands specially in older people. Are those veins or arteries? How can you c
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!