A. it has uracil
We know the sequence is RNA because it contains uracil.
Answer:
Correct
Explanation:
Homeostatic is nothing but ability of a system or living organism to manipulate its internal environment to maintain a stable equilibrium, for example the ability of warm-blooded animals to ascertain a constant body temperature.
The Homoeostatic feedback mechanism has three basis components and they are independent to one another.
These components are receptor, effector and integrating center. The function of receptor is to sense external stimuli and send information to integrating center. The integrating center generally hypothalmus in brain sends this signal to effector for example an organ to react to the stimuli.
So, the order in a homeostatic feedback system stimulus, receoptor, control centre, effector is correct.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
A. Twelve cells with 16 chromosomes each
Answer:
Id say a map
Explanation:
Globe is 3d, geometer is math, map is 2d, landmark is smth on a map
