In the adults, the growth rate slows with age. The healing mechanism of the different cells if damaged is different than that of the younger ones. If a cartilage is damage in the adults, the chondrocytes which are still surviving secrete more extracellular matrix in order to heal the damaged cartilage. The chondrocytes cells are present in the cartilage, and they function to maintain the cellular matrix of the cartilage.
<span>D is the correct answer. Coral reefs need sunlight to grow, so they grow best in shallow water (up to 50m deep) as this means sunlight can reach them. They require salt water to grow and warm temperatures of 20 - 32 degrees Celsius.</span>
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
hormones can stimulate cell regulators to increase cell reproduction. Thus option C is correct.
<h3>what are the role of hormones in reproduction ?</h3>
Hormones are the chemical messengers produced by the endocrine cells and it move through the blood, act on target cells.
The two most important reproductive hormones are estrogen in female and testosterone in male.
Estrogen induce the eggs development and maturation process in adult female and released during regular intervals of menstrual cycle.
Testosterone in male responsible for male gamete production.
Other hormones involved, such as Follicle stimulating hormone (FSH), Luteinising hormone (LH).
Thus option C is correct.
Learn more about hormones, here:
brainly.com/question/13260616
#SPJ1