1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrMuchimi
2 years ago
9

¿Cuál de los siguientes niveles es el sucesor del nivel tejido?

Biology
2 answers:
kirza4 [7]2 years ago
7 0
Answer: D
bcuz i said so and this
ahrayia [7]2 years ago
6 0

C. Órgano

Porque Célula→Tejido→Órgano→Sistema→Organismo

You might be interested in
6) the first plants and animals to inhabit a newly available ecosystem are the
pickupchik [31]
Species that arrive first in the newly created environment or available ecosystem are called PIONEER SPECIES
8 0
2 years ago
Which of these characteristics is shared by algae and seed plants?
Airida [17]
Have you got the list of characteristics on you? If not, both contain cells with chloroplasts, which is used to carry out the photosynthesis. Hope this helps.
6 0
3 years ago
according to this time table a train --------- at 3 o'clock .A will leave .B is leaving C. is going to ​
bija089 [108]
I’ll call him when you come over lol eueywuwuwyeyeoooqo is there anything you need me and i
3 0
2 years ago
Read 2 more answers
Which term specifically describes the categorization of people into ethnic groups without taking into account individual differe
zysi [14]

Answer: D) Stereotyping

Choice A is false because this involves denying a person to do something based on factors such as religion, race, ethnicity, etc.

Choice B is false because this term involves a crime or suspected crime being committed, or about to be committed. And it also makes the assumption based on a person's race.

Choice C is false since segregation is the separation of people usually by race or ethnicity. Though you could have class based segregation (eg: rich vs poor) and other forms.

Choice D is true because stereotyping is where you lump a bunch of people together based on cultural or societal assumptions. Usually it's in the form of "all ___ people do such and such" where you fill in the blank with a specific race or culture.

5 0
2 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Other questions:
  • During glycolysis, a molecule of glucose is partially oxidized. what is the net gain of atp and nadh for each glucose molecule d
    5·1 answer
  • What gloves work best for insulating against heat
    10·1 answer
  • Which of the following is the best description of the fluid mosaic model? A stationary triglyceride bilayer with fluid proteins.
    10·1 answer
  • Which of the following is not one of the reasons to properly warm up before exercising?
    7·2 answers
  • n which generation, sporophyte(2N) or gametophyte(N) do the following belong.a)Spore: _________b)Calyptra:________c) Egg: ______
    15·1 answer
  • Hi, if you could please help with this biology worksheet, it would be greatly appreciated!
    12·1 answer
  • What is the geological evidence that earth was covered with glaciers in the Precambrian???
    9·1 answer
  • Millions of years ago, a small population of birds lived on the Hawaiian Islands. Over time, this population evolved into more t
    12·2 answers
  • 17) If a substance has a pH of 14, it is...
    14·2 answers
  • What are the Rod shaped bacterias​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!