On his visit to the Galapagos Islands, Charles Darwin discovered several species of finches that varied from island to island, which helped him to develop his theory of natural selection.
Answer:
The Clean Water Act (CWA) can be considered as one of the effective program which impacted the water quality in the United States. Under this Act, quality standards for surface water were generated.
This Act has set wastewater standards for the industries and it ensures that industries do not pollute the clean water. The Clean Water Act (ACT) made it unlawful to discharge any pollutant in waters and set a fixed amount for it. Beyond that amount, polluting water is considered to be illegal.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
Mechanical Energy
Explanation:
In physics, "mechanical energy is the sum of potential energy and kinetic energy."
