1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anon25 [30]
3 years ago
8

¿Qué es el sujeto tácito?

Biology
1 answer:
pashok25 [27]3 years ago
8 0

Answer:

es la persona que ejecuta la accion esta omitida pero no hay duda de su existencia

Explanation:

Para ejecutar al sujeto en una oracion existen algunos indicios .La conjugacion del verbo, los pronombres,sujeto expreso en la oracion previa

POR EJEMPLO.

corremos todos los dias*sujeto táctil nosotros *

lo conoci hoy *sujeto táctil yo*.

You might be interested in
.....is a serious form of skin cancer that can spread to other parts of the body.
marusya05 [52]
Melanoma and squamous
7 0
3 years ago
The inflammation that tissues undergo when they become injured or irritated:​
Rashid [163]
The inflammation will not occur with tissue that is dead & has no blood supply. The injury brings a decrease in white blood cells. The Mast Cells play a role in releasing histamine which dilate capillaries and bring about hypermia cause increase blood and swelling and redness to the area
3 0
3 years ago
he viral capsid _______. Multiple Choice is dissolved engulfs the viral spikes surrounds the viral matrix protein becomes comple
Studentka2010 [4]

Answer:

Becomes completely enclosed by the region of the cell membrane into which the spikes and matrix protein are embedded

Explanation:

The viral capsid is a <em>protein shell that sorrounds a virus</em>, it serves as a criterion for the classification of viruses and <em>it encloses the genetic material of the virus and it has glycoproteins (spikes and matrix) embedded in it.</em>

I hope you find this information sueful and interesting! Good luck!

7 0
3 years ago
Indicate, as true or false, whether each of the following statements about species is a component of the biological species conc
adell [148]

Their reproductive isolation from each other is complete: False  

They are unable to produce hybrid offspring upon interbreeding: True  

They shared a common ancestor recently in evolutionary time: False  

Explanation:

A species known as a group of that organisms which can be potentially interbreed with another one to produce viable, fertile offspring. Prezygotic and postzygotic barriers separated the species from each other. It prevents the mating of viable fertile offspring.  

This process happens when groups in that species become reproductively diverge as well as isolated. In the formation of new species postzygotic and Prezygotic barriers play vital role.  

3 0
3 years ago
Crocodiles, lizards, and snakes are all reptiles. However, lizards are more closely related to snakes than to crocodiles. Which
Pachacha [2.7K]

Answer:

Crocodiles and snakes are more alike since they both develop from an egg.

Lizards and snakes are more alike since both species have a recent common ancestor.

5 0
3 years ago
Other questions:
  • What happens to the human body when the hart rate increases
    6·2 answers
  • Which event most accurately describes cytokinesis?
    11·2 answers
  • PLEASE HELP! WILL GIVE BRAINLIEST!!!!!
    6·1 answer
  • A cell membrane is very specific about what it allows across. How does this help the cell?
    8·2 answers
  • "bacteria first appear in the fossil record about 3.5 billion years ago. humans appeared in the fossil record only a few million
    12·1 answer
  • Ten square miles of temperate forest has a larger variety of organisms than 10 square miles of taiga
    7·1 answer
  • Predict the chemical formula of butyne, having one carbon-carbon triple bond.<br><br>C4H8
    6·1 answer
  • Contrast rocks and soil. List three differences.
    14·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Identify the effects of the vagus nerve on the following components of the digestive system Salivary glands Pyloric sphincter (g
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!