1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vichka [17]
3 years ago
9

Disruption of which organelle, would cause the most change in the function of the cell?

Biology
1 answer:
Allisa [31]3 years ago
8 0

Answer:

Is it a true or false question cuz it would be true

You might be interested in
Escherichia coli living in the human large intestine is known to produce vitamin K and B-complex vitamins in exchange for a nutr
jolli1 [7]

Answer:

Symbiosis

Explanation:

<em>Escherichia coli</em> is a species of Gram-negative bacteria that lives in the large intestine of  humans and animals that are <u>healthy</u>. There,<u> it produces important vitamins that humans need for nutrition, such as vitamin K, B-complex vitamins, which makes it essential for the proper functioning of our organism and our health</u>. In return,<u> it receives the nutrients it needs for growth and division</u>.

This species belongs to the group of essential microbiota of our organism that play an important role in our nutrition, metabolism, digestion, and even in our mood.

This means that <em>E. coli</em> lives in a symbiotic relationship with its host, the human. Therefore, if this species of bacteria is absent in our organism, due to antibiotic overuse for example, it could have important negative impacts in our health.

3 0
3 years ago
Why is this conversion of energy from one molecule to another necessary for all cells?
Ivenika [448]

\mathfrak{\huge{\orange{\underline{\underline{AnSwEr:-}}}}}

Actually Welcome to the Concept of the energy conversion

=> ATP can be used to store energy for future reactions or be withdrawn to pay for reactions when energy is required by the cell.

=> When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP).

8 0
3 years ago
Explain what frame shift means and is it more or less likely to cause a noticeable mutation than a substitution
harina [27]

Answer:

A frameshift mutation can be described as a genetic mutation in which a single nucleotide or more than one nucleotide is inserted or deleted from the sequence of the DNA. As the gene expresses itself in the form of triplets of a genetic code, insertion or deletion can cause devastating changes in the genetic code due to which wrong proteins will be synthesized.

Frameshift mutations can be more noticeable than the substitution mutation. In a substitution mutation, only one of the nucleotides is shifted with another. The entire genetic code is not affected by it.

3 0
3 years ago
A scientist attends an annual conference hosted by the American Medical Association. At which type of event is she most likely t
Anvisha [2.4K]
<span>A. Keynote address

In the Keynote address is most likely a world-famous surgeon would give his/her speech in order to motivate, inspire and challenge pursing scientists and medical professionals in their pursuit of their successful career and the like endeavors. </span>
8 0
3 years ago
Read 2 more answers
Phytoplankton are the main primary producers on land.
PilotLPTM [1.2K]

Answer:

false

Explanation:

Phytoplankton are from the water and not found on land.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Enzymes in the __________ are important in the metabolization of drugs.
    13·1 answer
  • The formula v2 = G is very useful for astronomers because it does not require them to know T. What does T stand for? orbital per
    15·2 answers
  • What is the definition of Organelle? And what could be a good example?
    9·1 answer
  • - Study the statement above. Nitrogen is NOT a part of
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • All of the following are benefits of sequencing the human genome except knowing:
    11·1 answer
  • What causes the inside of the membrane to reverse charge
    5·1 answer
  • Which of the following attributes of and organism cannot be seen by observing the organism?
    6·2 answers
  • A converging lens can be defined as ___
    11·1 answer
  • Can someone help me​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!