1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnesinka [82]
3 years ago
14

Which of the following are true of line graphs?

Mathematics
1 answer:
ASHA 777 [7]3 years ago
6 0
Specific data is show I believe
You might be interested in
What is input<br> what is output
uranmaximum [27]

Step-by-step explanation:

Input:

Input is generally defined as the information that is sent or passed to a computer or the information what is taken.  The devices that are used to give or offer such information is know as Input devices.

For example:  

We usually use keyboard to type and give a specific data to the computer and hence it can be considered as an Input device.

Output:

Output is generally defined as the source of information that is received or processed by the computer or the information what is given back. The devices that are used to give back such information is know as Output devices.

Example:

Printers takes the input from us,process it and gives back the output in the form of printed sheets,Hence it can be considered as Output device.

5 0
3 years ago
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
Help i give crown ples what is the vaule of the underlind 4
DerKrebs [107]

Answer:

A B and D.

Step-by-step explanation:

4 • 1/10 = 0.4

Four Tenths = 0.4

0.4 = 0.4

6 0
3 years ago
When writing a repeating decimal as a fraction does the number of repeating digits use matter
Gala2k [10]

Answer:

see below

Step-by-step explanation:

yes it matters, if you don't know how to write a repeating decimal as a fraction you can use this trick

let's say we don't know what it is

0.33333333...

so we see that there's only one repeating digit

so the answer is

(the repeating digit)/(9)=3/9

and that simplyfies to 1/3

let's try another one

0.67676767...

as you can see know the repeating is 67

so the answer is

(the thing that repeats)/(99)=67/99

do you see a pattern?

when we have a number x of repeating decimals

the denominator of the fraction (the thing that's down) is 9999..99 in there must be x 9's

let me explain

if you have 3 repeating decimals

the denominator will be 999

you see 3 nines

and so on.

8 0
3 years ago
840, 180, 40, 10,...
Dafna11 [192]

Exponential decay and range will be the set of natural numbers

4 0
4 years ago
Read 2 more answers
Other questions:
  • The ratio of dogs to cats is ?? to ??
    9·1 answer
  • (X-1)^2 + (y + 3)^2= 4
    8·1 answer
  • |8| - |5| why do I have to do 20 characters
    11·2 answers
  • Explain how you can prove RST is congruent to UVW by asa
    11·1 answer
  • Complete the point-slope equation of the line through (6, 4) and (7, 2)
    5·1 answer
  • Find the slope of the line passing through the points (-4, -4) and (2, 5)​
    7·1 answer
  • Witch method can be used to find the range of a set of data
    10·1 answer
  • Solve this :9x + 3 &lt; 21
    8·1 answer
  • Decrease £101 by 43%
    13·2 answers
  • Each bowl can hold 3 tomatoes. There are a total of 16 tomatoes. How<br> many bowls do you need!
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!