1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-BARSIC- [3]
3 years ago
15

Select all that are true about carbon.

Biology
1 answer:
sukhopar [10]3 years ago
7 0
I would say

It’s found in water.

It can make up to 8 covalent bonds.

and

The molecules it forms can have several shapes.
You might be interested in
What tissue keeps the bones from grinding on each other? A. muscles B. cartilage C. tendons
Blababa [14]
The correct answer is C, tendons. They are in between the bends/gaps in our bones. I hope I helped :)
7 0
3 years ago
Consider a gene with three alleles controlling coloration of a flowering plant. There are 3 possible phenotypes, corresponding t
Andrews [41]

Answer:

C. A1A2, A1A3

Explanation:

This question depicts a gene coding for coloration in a flowering plant. The gene is controlled by multiple alleles, three specifically. The alleles are labelled A1, A2, and A3, with each coding for it's own respective trait.

According to the question, A1 is dominant over A2 and A3 i.e. A1 will always mask the phenotypic expression of A2 and A3 and express itself. Also, A2 is dominant over A3 i.e. A2 will always mask the phenotypic expression of A3. This overall means that the trait encoded by allele A3 will only be expressed when the same alleles are present.

To the question; since A1 is dominant over the other two alleles (A2 and A3), it will be phenotypically expressed ahead of them in a heterozygous state with both alleles. That is, A1A2 genotype will give rise to a phenotype encoded by A1. Also, A1A3 will produce a phenotype encoded by A1. Hence, genotypes A1A2 and A1A3 will express the same phenotypes.

A2A2 and A3A3 will express different phenotypes since they are both in a same alleles condition. Likewise for A1A1 and A3A3. A2A3 and A1A3 genotypes will express different phenotypes encoded by A2 and A1 respectively since they are both dominant over A3.

3 0
3 years ago
Which type of reproduction involves both parents?
larisa86 [58]
D is the correct answer
6 0
3 years ago
Read 2 more answers
How does crossing over break up linkage between alleles?
Ede4ka [16]

It involves a physical exchange of segments from homologous chromosomes. Because of crossing over, alleles originally located on the same chromosome can end up on different chromosomes and be inherited independently


3 0
3 years ago
Whats the purpose on an enzyme?
alex41 [277]
The purpose of an enzyme is to allow the cell to carry out chemical reactions very quickly
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which organisms have cell membranes and which do not
    11·1 answer
  • 20. Identify the stage of mitosis that the following events occur in
    9·1 answer
  • A trait is a specific characteristic that varies from one individual to another. true or false.
    14·1 answer
  • The organization of similar organisms into groups helps scientists understand how living things are related. it also allows scie
    6·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Which of the following is true of a eukaryotic cell in a multicellular organism? a.possess ribosomes
    7·1 answer
  • The amount of matter in the Earth system remains constant over time. The forms and locations of the matter stored within the sys
    13·1 answer
  • What are the two ways a hypothesis can be solved?
    8·1 answer
  • A scientist observed that penguins move efficently through water.the scientist makes a that if a boat is designed with a propuls
    11·1 answer
  • Explain the Carbon cycle in 3 paragraphs or more.​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!