<span><span>Implement a personal hygiene program. To lessen the possibility of food handlers contaminating food, institute a good personal hygiene program that includes policies addressing critical hand practices like proper handwashing, hand care and glove use. Also address staff cleanliness and work attire, focusing on topics such as bathing, clean clothing, the proper use of hair restraints and prohibited jewelry. Finally, policies should be put in place to make sure food handlers come to work healthy. Include actions such as reporting illnesses and covering wounds.</span><span>Remind employees to wash their hands. This is especially important after using the restroom and after handling raw meat, seafood and poultry. Once employees have washed their hands, ensure they use a single-use paper towel or hand dryer, rather than any part of their uniform, to dry. </span><span>Use separate equipment. Each type of food should be prepped and handled with a separate piece of equipment. For example, use one set of cutting boards, utensils and containers for raw poultry. Use another set for raw meat, and use a third set for produce. Some operations use colored cutting boards and utensil handles to help keep equipment separate. If this system is not possible at your restaurant, prep food at different times.</span><span>Clean and sanitize all work surfaces. All work surfaces, equipment and utensils should be cleaned and sanitized after each task. Simply rinsing equipment is not enough to eliminate pathogens that can contaminate food. </span><span>Purchase prepared food. You can prevent cross-contamination by purchasing food that doesn’t require much prepping. This minimizes handling and can reduce the transfer of pathogens from one surface or food to another.
</span></span>
Okay, so this is physics. What is the meaning of KE? It's Kinetic Energy. What is the meaning of GPE? It's Gravitational Potential Energy. So how do you calculate either, and what are their significances? Kinetic -> motion, Gravitational potential energy -> energy that can be used to do work due to gravity. So is the bowling ball moving, or is it someplace it can fall from, or both?
Kinetic energy is calculated as 1/2 * mv^2, where m is the mass of the object, and v is the velocity. Potential energy for conservative forces is the product of the force and the distance over which it can do work. Thus in the case of GPE, it is the weight multiplied by the height, as gravity is a conservative force. What is the weight? It's not equal to the mass.
Hopefully these hints will get you thinking.
The correct answer is the insertion.
<span>Insertion is the attachment site of the muscle end that does move when the muscle contracts. On the other hand, the origin is the attachment site that does not move during contraction (end of the muscle is fixed).</span>
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
