1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
7

Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque

nce correctly into mRNA and translate it into the correct protein sequence.
a. 5’CATTGACAGCTTGATGACAGATGCAGTATAATGCGATTAGCTATGACGGACGTAGCTAGCAGCTGACGCCAGGCTT

b. 3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
Biology
1 answer:
Degger [83]3 years ago
7 0

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

You might be interested in
In an ecosystem, organisms can be divided into producers and consumers. Producers are organisms that use sunlight directly for f
svetlana [45]

The right answer is C. Level 1 (bottom).

Ecological pyramids occur in their basic producers (such as plants) and follow a sequence of several trophic levels (such as herbivores that eat plants, carnivores that eat herbivores, followed by carnivores that eat carnivores, And so on). The highest level is the top of the food chain leads to superpreders.

3 0
3 years ago
Read 2 more answers
What is the function of the highlighted organelle​
s2008m [1.1K]

Answer:

Convert nutrients from food into ATP

6 0
3 years ago
Read 2 more answers
If an animal has radial symmetry, what phylum is it classified to be?
storchak [24]

Answer:

D-Cnidaria

Explanation:

took the test

6 0
2 years ago
For half of the radioisotopes of a certain kind to decay into its more stable isotope, the amount of time required is called the
alisha [4.7K]

Answer:

For the half of the radioisotopes of a certain kind to decay into more stable isotope, the amount of time required is called The Half Life.

Radiocarbon dating is typically used to date more recent objects like bones, cloth, wood, and plant fibers.

Sedimentary rocks cannot be accurately dated using isotope dating because this Rock type is formed through the sedimentation of different rocks and minerals fragment.

Using the principle of faunal succession, scientist can determine the age of rocks by the fossil flora and fauna embedded within them.

Explanation:

Carbon dating is a process which is done by the use of carbon 14 atom. It is a special type of atom which can easily help the scientist and expert to find out the age of the fossil of flora and fauna, rocks, animals, birds, etc.  

4 0
4 years ago
Read 2 more answers
Pls help me , if I get this right I get a A
yawa3891 [41]

Answer:

np answer is co2

Explanation:

5 0
3 years ago
Other questions:
  • One parrot species that feeds on large seeds nests is in the same tree as a parakeet that feeds on small seeds. How are the bird
    14·2 answers
  • The air component in soil provides plants with the___ needed for photosynthesis
    9·2 answers
  • Which of the following is true about the cells of an animal’s body?
    7·1 answer
  • What is a limitation of using electron microscopes to view specimens?
    11·1 answer
  • 12. The proteins and lipids, essential for building the cell membrane, are
    11·1 answer
  • Explain the difference between a seamount and a volcanic island.
    11·2 answers
  • Which of the following accurately describes HIV?
    8·2 answers
  • Difference between plant and animal tissues give me 6 points in tabular form
    5·1 answer
  • :-) :-) :-) :-) :-) :-) :-) :-) :-)
    10·1 answer
  • How does innate behaviors help organisms maintain<br> homeostasis.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!