1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
7

Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque

nce correctly into mRNA and translate it into the correct protein sequence.
a. 5’CATTGACAGCTTGATGACAGATGCAGTATAATGCGATTAGCTATGACGGACGTAGCTAGCAGCTGACGCCAGGCTT

b. 3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
Biology
1 answer:
Degger [83]3 years ago
7 0

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

You might be interested in
Poniżej podano funkcje elementów budujących układ oddechowy. Zaznacz odpowiedź dotyczącą płuc. Jest narządem odpowiedzialnym za
Mandarinka [93]

Answer:

umm how is this a question?

3 0
3 years ago
WORD BANK HELP
Sergio039 [100]
<span>Selective breeding (also called artificial selection) is the process by which humans use animal breeding and plant breeding to selectively develop particular phenotypic traits (characteristics) by choosing which typically animal or plant males and females will sexually reproduce and have offspring together. (Domesticated) animals are known as breeds, normally bred by a professional breeder, while domesticated plants are known as (varieties), cultigens, or cultivars. Two purebred animals of different breeds produce a (crossbreed). Flowers, vegetables and fruit-trees may be bred by amateurs and commercial or non-commercial professionals: major crops are usually the provenance of the professionals. </span>
6 0
3 years ago
The adaptive response is a specific response that takes longer to activate and includes cells such as effector cells and antibod
AveGali [126]

Answer: b

Explanation:

8 0
3 years ago
Identify and define the four types of starch and liquid mixtures
maksim [4K]

Answer:

cornstarch, potato starch, rice starch, tapioca starch and fruit juice, stock, vegetable juice, water, wine Explanation:

8 0
4 years ago
Making more cells is needed for growth, development, and _____________ repair
Kaylis [27]

Answer:

tissue

Explanation:

7 0
3 years ago
Other questions:
  • What are the characteristics of a buckeye leaf?a: needlelike simple leaves attached opposite each other on the branchb: broad si
    15·2 answers
  • How can carbohydrates, lipids, and proteins be detected in foods?
    5·1 answer
  • How is homeostasis and metabolism interrelated?
    5·1 answer
  • Why is it important we reduce the amount of greenhouse gases we<br>put into the atmosphere?​
    10·2 answers
  • If glaciers on Greenland grew larger, The crust under the ice would experience, uplift, subduction, or subsidence?
    13·1 answer
  • During the process of mitosis, the chromosomes
    6·1 answer
  • What do you think the seed need to make it start to grow​
    9·2 answers
  • During the replication of DNA:
    15·2 answers
  • Saliva flows out of the salivary glands into your mouth is it diffusion osmosis or neither
    11·1 answer
  • What are characteristics or examples of phylum annelida? (select all that apply.)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!