1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
7

Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque

nce correctly into mRNA and translate it into the correct protein sequence.
a. 5’CATTGACAGCTTGATGACAGATGCAGTATAATGCGATTAGCTATGACGGACGTAGCTAGCAGCTGACGCCAGGCTT

b. 3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
Biology
1 answer:
Degger [83]3 years ago
7 0

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

You might be interested in
Individuals with more than healthy fat levels but who are not considered obese have body fat levels in the zone.
sergejj [24]
They have body fat level in the MARGINAL OR BORDERLINE ZONE. At this zone, the fat level in the body is higher than the acceptable levels but is less that the fat levels in the obese people. With this level of fat, one has higher risks for such diseases such as high blood pressure, heart diseases, etc.
7 0
3 years ago
Which of the following would be classified as concepts in anatomy?
Lera25 [3.4K]

Concepts in anatomy from the given options include:

  • The brain is composed of two hemispheres.
  • Each kidney contains approximately 6-10 pyramids.
  • The muscle on the back of the arm has three heads of origin.
  • Study of form.

<h3>What is anatomy?</h3>

Anatomy is a branch of biology that is concerned with the study of the structure of living organisms and their various parts.

Anatomy studies the position of body structures as well as the position of related structures or organs of the body.

Anatomy also studies how the structure of these body parts relates to their functions.

Therefore, concepts in anatomy from the given options are:

  • The brain is composed of two hemispheres.
  • Each kidney contains approximately 6-10 pyramids.
  • The muscle on the back of the arm has three heads of origin.
  • Study of form.

In conclusion, anatomy deals with structure of body parts of living organisms.

Learn more about anatomy at: brainly.com/question/896286

#SPJ1

3 0
1 year ago
How are endocytosis and exocytosis different from diffusion?
gladu [14]
Exo is spitting big things out. endo is pulling big things in. diffusion is molecules moving from an area of high concentration to an area of low concentration until it is balanced
4 0
3 years ago
What types of individuals in a population are represented by the two ends of a bell curve
Ivanshal [37]
The people represented by the ends of the bell-curve are the most rare.

This could mean that if it's an iq curve the people at the ends have either a really high or really low iq etc.
8 0
3 years ago
How are spring tides different from Neap Tides. Give at least 2 reasons _______
dybincka [34]

Answer:

Seven days after a spring tide, the sun and moon are at right angles to each other. This produces moderate tides known as neap tides, meaning that high tides are a little lower and low tides are a little higher than average. Neap tides occur during the first and third quarter moon, when the moon appears "half full.

6 0
2 years ago
Other questions:
  • The nurse is caring for a child with epididymitis. when planning care, which intervention may be included?
    8·1 answer
  • In what ways are red invasive fire ants costly?
    12·2 answers
  • An infant is admitted to the intensive care unit with multiple injuries. when the adolescent mother sees her infant for the firs
    5·1 answer
  • What are some advantages of breeding strategies
    10·1 answer
  • What does it represent?
    9·2 answers
  • Jayla and her grandma are designing a lunchbox. The lunchbox will be made out
    11·1 answer
  • A grocer stacks oranges in a four-sided pyramid that is 6 layers high. Solve for the number of oranges in the pile.
    13·2 answers
  • In the scientific name Puma concolor, Puma is consider the
    8·1 answer
  • Can squirrels get cats pregnant?!?!?! please answer quickly :/
    6·2 answers
  • HELP PLS BRAINLIEST!!!
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!