1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
7

Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque

nce correctly into mRNA and translate it into the correct protein sequence.
a. 5’CATTGACAGCTTGATGACAGATGCAGTATAATGCGATTAGCTATGACGGACGTAGCTAGCAGCTGACGCCAGGCTT

b. 3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
Biology
1 answer:
Degger [83]3 years ago
7 0

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

You might be interested in
Non vascular plants include.....
LUCKY_DIMON [66]
D because they lack roots, stems, and leaves. Nonvascular plants are low-growing, reproduce with spores, and need a moist habitat.
6 0
3 years ago
Do centralean diatoms have symmetry
IgorLugansk [536]
They have bilateral symmetry and a rounded shape. 

8 0
3 years ago
Which element is found in nucleic acids but not in amino acids
Sergio039 [100]

Answer:

Phosphorus

Explanation:

idk amino acids contain carbon hydrogen oxygen and nitrogen as well as sulfur sometimes

nucleic acids contain phosphorus as well as carbon hydrogen and nitrogen

4 0
3 years ago
Why do "You Think" some bacteria grow better in your gut rather than your lungs or skin?
Phoenix [80]

Million of bacteria grow in our gut and each have their own set of genes , that helps them to survive acidic environment of the gut. They can have both beneficial and harmful effect to your health.

While the bacteria in lungs causes symptoms similar to the cold or flu, it can be more severe and typically last longer. Immune system will typically be able to clear a viral lung infection over time. Infections can be cured by using antibiotics also .

On the other hand bacteria on skin can survive up to 20 minutes .Human skin also act as barrier that limits invasion and growth of pathogenic bacteria. Human body has a lot of defenses to keep the bad bacteria from coming in too far through these openings.

To learn more about Bacteria , here

brainly.com/question/8008968

#SPJ1

7 0
1 year ago
If a heterozygous type A (ABO blood type) male crossed with a type O female, what would be the phenotypic ratio of type A: type
Alenkasestr [34]

Answer:

2/4 A and 2/4 O

Explanation:

8 0
3 years ago
Other questions:
  • An atom consist of an atomic nucleus composed of positvely charged
    14·1 answer
  • What Are the Differences Between Eukaryotic and Prokaryotic Cells? <br><br> Written response
    7·2 answers
  • if it takes 5 seconds for the sound of thunder to travel 1 mile,how many miles was the person from the lightening bolt?
    13·1 answer
  • A scientist asks a question and discovers that increased temperature decreases the number of offspring that an organism produces
    9·1 answer
  • Identify the lysogenic virus:<br> A. Measles <br> B. Chicken pox<br> C. Small pox <br> D. Flu
    11·2 answers
  • Which condition is a malignant tumor composed of blood-forming tissues of the bone marrow?
    9·1 answer
  • The atmosphere and oceans are constantly moving.Their activity is due primarily to____?
    6·1 answer
  • Which effect of temperature rise causes a feedback resulting in a rise in global temperatures?
    11·1 answer
  • What is some evidence that makes plate tectonics is such a firmly believed idea?
    7·1 answer
  • If there are 7.6 billion people, why can't I get a gorlfriend?<br>​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!