1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
7

Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque

nce correctly into mRNA and translate it into the correct protein sequence.
a. 5’CATTGACAGCTTGATGACAGATGCAGTATAATGCGATTAGCTATGACGGACGTAGCTAGCAGCTGACGCCAGGCTT

b. 3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
Biology
1 answer:
Degger [83]3 years ago
7 0

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

You might be interested in
Before cell reproduction or mitosis can proceed, what is the correct sequence of steps that must first occur?
ollegr [7]

D.growth, duplication of cell organelles, chromosome replication, repair of chromosomal errors

4 0
4 years ago
How many atoms are in a 70 kg human?
topjm [15]

Answer:

7 followed by 27 zeros

Explanation:

The body of an adult man weighing 70 kg is made up of approximately 6.7 • 10 ^ 27 atoms.

The body of an adult male contains approximately 57% water, but if we look by weight, hydrogen is only 11%, while if we look at the mutual ratio of atoms in water, there are a total of 67% hydrogen atoms.

In this way, most of the weight (mass) of the human body comes from oxygen, but most of the atoms in the body are hydrogen.

4 0
3 years ago
Please help jdixnwjdj
Ksivusya [100]

Answer: Homeostasis

Explanation: One way that a cell maintains homeostasis is by controlling the movement of substances across the cell membrane. The lipid bilayer is selectively permeable to small, nonpolar substances. Proteins in the cell membrane include cell-surface markers, receptor proteins, enzymes, and transport proteins.

6 0
3 years ago
Need help with this smart people only pls
r-ruslan [8.4K]

Answer:

The answers you have chosen are/should correct

Explanation:

Already took that test

7 0
3 years ago
Read 2 more answers
Derived from a 6 membered ring. Contains Cytosine, Thymine, and Uracil.
dybincka [34]

Answer:

b. Nucleotides  

Explanation:

Nucleic acids are examples of structures formed from nucleotides. And in relation to the composition of DNA, we have the formation of the largest cellular macromolecule, all formed by nucleotides.

The nucleotide is a group formed by the association of 3 molecules - a nitrogen base, a phosphate group and a pentose glycide. Thus, we may have variations within these ligands, such as: in DNA we have the presence of pentose deoxyribose, while in RNA we have the presence of pentose ribose.

The nucleotides have differences in relation to its nitrogen base, which can be purine or pyrimidine. Purine bases vary in Adenine and Guanine, while pyrimidine bases are classified in Thymine, Uracil and Cytosine. Purine and pyrimidine bases are complementary and each have specific binders. Thus, we have that the purine base Adenina, binds with the pyrimidine bases Timina and Uracila, while the base Guanina binds exclusively to Cytosine and vice versa.

5 0
3 years ago
Other questions:
  • Coral reefs are made of
    5·1 answer
  • Type of active transport were food like molecules are transported into the cell
    7·1 answer
  • Secondary structures are stabilized by which type of interaction?
    8·1 answer
  • Why do viruses reproduce
    8·2 answers
  • 8.   Modern fishing practices threaten biodiversity mainly through the
    6·2 answers
  • How many amino acids are common to all living systems?
    5·1 answer
  • Glaciers pick up large rocks and carry them away. This is called _____.
    6·2 answers
  • Between your evening meal and breakfast, your blood glucose drops and your liver becomes a net producer rather than consumer of
    6·2 answers
  • 100 points! The diagram shows steps and structures involved in protein production.
    5·2 answers
  • How might an increase in the use of fertilizers affect the catfish carrying capacity
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!