1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
7

Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque

nce correctly into mRNA and translate it into the correct protein sequence.
a. 5’CATTGACAGCTTGATGACAGATGCAGTATAATGCGATTAGCTATGACGGACGTAGCTAGCAGCTGACGCCAGGCTT

b. 3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
Biology
1 answer:
Degger [83]3 years ago
7 0

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

You might be interested in
How does the tapeworm prevent itself from being removed along with the waste?
Setler79 [48]
Tape worms have numerous adaptations to enhance their survival in the hosts. 
For example the have anatomical adaptations in the form of scolex with hooks that they use to attach to the host small intestine walls therefore preventing them from being excreted following peristalsis. Therefore, the correct answer is that they posses hooks that they use to attach to the small intestines. 
4 0
3 years ago
Through the 1973 endangered species act, __________ u.s. species have been listed as endangered or threatened with recovery plan
gizmo_the_mogwai [7]
2,200 species, and recovery plans were approved or implemented for invasive species.
5 0
3 years ago
Which of these is a source of phosphorus in the environment ?
Brut [27]
What are the options?
6 0
2 years ago
Read 2 more answers
Angiotensin II is a potent ____________ that helps regulate blood pressure. Angiotensinogen, is an inactive hormone synthesized
Hatshy [7]

Answer:

Angiotensin II is a potein VASOCONSTRICTOR that helps regulate blood pressure. Angiotensinogen, is an inactive hormone synthesized and released continuously from the LIVER. Its activation, which occurs within the BLOOD, is initiated by the enzyme renin. Renin is released from the juxtaglomerular apparatus of the KIDNEYS in response to either (1) LOW blood pressure (as detected by decreased stretch of BARORECEPTORS within granular cells, or by decreased NaCl detected by CHEMORECEPTORS within macula densa cells); or (2) stimulation by the SYMPATHETIC  division. The sequential action of renin and angiotensin converting enzyme (ACE) causes the formation of angiotensin II (the active form of the hormone).

Explanation:

Angiotensin is a peptide hormones that regulate blood pressure by causing increase in blood pressure through vasoconstriction. It is a part of the renin- angiotensin system that regulate the internal pressure of the blood. It is stimulated when the level of blood pressure reduces or there is an decrease in the sodium chloride in the blood. It effects is to vasoconstrict the blood vessels thereby increasing the blood pressure in the vessels. Angiotensinogen is the inactive hormone synthesized by the liver and upon activation through baroreceptors or chemoreceptors, the liver releases angiotensinogen into the blood stream to be ctivated by the enzyme secreted from the kidney's juxtaglumerular apparatusand then activated to teh angiotensinogen I, angiotensinoI is then activated into angiotensin II by the angiotensin II by the angiotensin converting enzyme. Angiotensin also causes the increase in the aldosterone secretion from the adrenal cortex to promote the retention of sodium by the kidneys, this also helps to increaee the blood pressure. Various receptors helps in signalling the body to a reduced blood pressure level. This includes the baroreceptors which are pressure receptors and detect changes in pressure of the blood; chemorecptors which are chemical receptors that detect the change in the concentration of sodium and chloride ion in the blood. All this function together with the sympathetic division of the CNS to help the body regulates its change in blood pressure in a given time.

3 0
3 years ago
6) What term describes an educated guess that needs to be tested by
faltersainse [42]
Theories are educated guests that are tested by experiments
4 0
2 years ago
Other questions:
  • The Doppler effect indicates that the universe is expanding because_____
    15·2 answers
  • Find the Aleutian trench that is circled on the map seen here. This area is the site where two tectonic plates meet. Islands hav
    12·2 answers
  • A 14-year-old female cheerleader reports gradual and progressive dull anterior knee pain, exacerbated by kneeling. she also comp
    11·2 answers
  • In lemmings, gray (G) fur is dominant over white (g). There is a second gene called color (C), and individuals must have at leas
    12·1 answer
  • 3 common organisms that are made up of Eukaryotic cells examples
    15·1 answer
  • Look at the pic below and tell me which one to pick
    9·2 answers
  • How would the presence or lack of a variety of animals affect the loss or growth of a plant's habitat?
    14·2 answers
  • 1. Define carrier
    13·2 answers
  • What is a SNP mutation?
    5·1 answer
  • . Insulin controls the insulin level in ____________
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!