1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
7

Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque

nce correctly into mRNA and translate it into the correct protein sequence.
a. 5’CATTGACAGCTTGATGACAGATGCAGTATAATGCGATTAGCTATGACGGACGTAGCTAGCAGCTGACGCCAGGCTT

b. 3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
Biology
1 answer:
Degger [83]3 years ago
7 0

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

You might be interested in
4. Compare and contrast a mechanical wave and an elec-
densk [106]

Answer:

difference:

1. The generation mechanism is different, the mechanical wave is generated by mechanical vibration; the electromagnetic wave generation mechanism is also different, there is the periodic movement of electrons (radio waves); the outer electrons with atoms are generated after being excited (infrared, visible, ultraviolet) The inner electrons with atoms are generated after excitation (roentgen rays); the nuclei with atoms are generated after excitation (gamma rays).

2. The propagation mechanism is different: the mechanical interaction between the particles and the alternating induction of the electromagnetic field.

3. Mechanical waves have both transverse waves and longitudinal waves; electromagnetic waves are material waves and belong to transverse waves.

4. The influence of the medium on the propagation speed is different

Explanation:

https://qiaodahai.com/similarities-and-differences-between-mechanical-waves-and-electromagnetic-waves.html

7 0
4 years ago
Ranjeet is studying an unknown group of cells and finds that the cells have lysosomes. He concludes that the cell must be an ani
Veronika [31]
No as lysosomes also can be found in plant cells and other organisms.
3 0
3 years ago
The diagram below shows some subatomic particles.
galina1969 [7]
It is neutrons for sure have a great day
7 0
3 years ago
In order for evolution to occur, which of these conditions must be met?
Yuki888 [10]

Answer:

population need to be willing to adapt to their environment

6 0
3 years ago
Can someone help me please
ziro4ka [17]
The electron transport chain and ATP synthase are embedded in the inner mitochondrial membrane.The electrons flow through the electron transport chain, causing protons to be pumped from the matrix to the intermembrane space. Eventually, the electrons are passed to oxygen, which combines with protons to form water.
4 0
3 years ago
Other questions:
  • The stem of some plants serve all but one of these functions?
    11·1 answer
  • It became apparent to Watson and Crick after completion of their model that the DNA molecule could carry a vast amount of heredi
    13·1 answer
  • Someone good at biology help? It's about insulin pumps ..?
    7·1 answer
  • What an organism looks like, or other detectable characteristics, is its ______ .
    11·2 answers
  • Question 3 of 25
    6·2 answers
  • Why is Earth's outer core hotter than Earth’s oceanic crust? Earth’s oceanic crust is denser than Earth’s outer core is. Earth’s
    13·2 answers
  • What type of vaccine is the live, weakened measles virus?
    11·1 answer
  • Order the steps required to analyze gene expression from a particular cell type using a dna microarray.
    7·1 answer
  • HELP ASAP PLS!!! Which of the following statements is correct about nonsexual touch as it relates to older adults?
    13·2 answers
  • Help me plssssssssssss
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!