1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tom [10]
2 years ago
5

. The small fish are not affected by the pesticide, but death occurs in the bird, at the top of the food chain. Why do you think

that happens?
Biology
1 answer:
andreev551 [17]2 years ago
8 0

Small fish absorb minute amounts of pesticides.

The birds of prey consume many fish to satisfy their dietary needs. The pesticides accumulate and concentrate in the bird, continued exposure overwhelm the predator.
You might be interested in
What do all vertebrates and invertebrates have in common?
Rudiy27
Animals can be classified into two main groups:vertebrates and invertebrates<span>. The main difference between </span>vertebrates and invertebrates<span> is that</span>invertebrates<span>, like insects and flatworms, </span>do<span> not</span>have<span> a backbone or a spinal column. Examples of</span>vertebrates<span> include humans, birds, and snakes. hope this helped</span>
8 0
3 years ago
Read 2 more answers
The circular folds of the small intestine enhance absorption by causing the chyme to spiral, rather than to move in a straight l
Pavlova-9 [17]

Answer:

The correct answer will be- true.

Explanation:

The small intestine is the longest part of the gastro-intestinal tract which helps in the absorption of nutrients from the digested food.

The structure of small intestine contains cell membrane extensions called villi and micro-villi which increases the surface area for absorption. The small intestine increases the food absorption by peristaltic movement of the food chyme. The small intestine causes the food chyme to form spirals which passes the food to large intestine.

Thus, true is the correct answer.

8 0
2 years ago
Understanding wobble rules select all the anticodons that could bind to the codon for serine. choose all that apply. check all t
Kipish [7]

A codon is a tree letter nucleotide sequence in the mRNA. The tRNA anticodon attached to the corresponding amino acid recognizes the mRNA codon. A single amino acid can have more than one codon. 

The serine codon can be one of the following:

<span>TCT, TCC, TCA, TCG, AGT, AGC</span>

8 0
3 years ago
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
Hatshy [7]

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

4 0
3 years ago
Read 2 more answers
Consider the differential equation dy/dx = (y - y^2)/x.
Vika [28.1K]
We need to show that y = x/(x + c) is a solution of dy/dx = (y - y^2)/x. Then, 

<span>dy/dx = ((x + c) * 1 - x * 1)/(x + c)^2 </span>
<span>= (x + c - x)/(x + c)^2 </span>
<span>= c/(x + c)^2 </span>

<span>and </span>

<span>(y - y^2)/x = (x/(x + c) - x^2/(x + c)^2)/x </span>
<span>= (x(x + c) - x^2)/(x(x + c)^2) </span>
<span>= (x^2 + cx - x^2)/(x(x + c)^2) </span>
<span>= cx/(x(x + c)^2) </span>
<span>= c/(x + c)^2 </span>

<span>which proves the equality. </span>
7 0
3 years ago
Other questions:
  • What happens in chemosynthesis?
    14·2 answers
  • The N-H bond in ammonia is polar because
    11·2 answers
  • What hormonal change occurs after fertilazation that causes the endometrial lining to remain intact so that the fertilised egg c
    11·1 answer
  • One of the differences between calderas and craters is that the crater is than the caldera.
    11·2 answers
  • Please help with number 8,9and 10
    8·1 answer
  • What are some similarities for prophase and telophase
    12·1 answer
  • Chromista ______.
    7·1 answer
  • GIVING BRAINLIEST AND THE REST OF MY POINTS!!!! :)
    6·1 answer
  • What does meiosis typically result in the production of?
    8·1 answer
  • Part A: Analyze the experimental setup. Explain if students effectively managed the variables in this experiment.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!