Animals can be classified into two main groups:vertebrates and invertebrates<span>. The main difference between </span>vertebrates and invertebrates<span> is that</span>invertebrates<span>, like insects and flatworms, </span>do<span> not</span>have<span> a backbone or a spinal column. Examples of</span>vertebrates<span> include humans, birds, and snakes. hope this helped</span>
Answer:
The correct answer will be- true.
Explanation:
The small intestine is the longest part of the gastro-intestinal tract which helps in the absorption of nutrients from the digested food.
The structure of small intestine contains cell membrane extensions called villi and micro-villi which increases the surface area for absorption. The small intestine increases the food absorption by peristaltic movement of the food chyme. The small intestine causes the food chyme to form spirals which passes the food to large intestine.
Thus, true is the correct answer.
A codon is a tree letter nucleotide sequence in the mRNA. The tRNA anticodon attached to the corresponding amino acid recognizes the mRNA codon. A single amino acid can have more than one codon.
The serine codon can be one of the following:
<span>TCT, TCC, TCA, TCG, AGT, AGC</span>
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
We need to show that y = x/(x + c) is a solution of dy/dx = (y - y^2)/x. Then,
<span>dy/dx = ((x + c) * 1 - x * 1)/(x + c)^2 </span>
<span>= (x + c - x)/(x + c)^2 </span>
<span>= c/(x + c)^2 </span>
<span>and </span>
<span>(y - y^2)/x = (x/(x + c) - x^2/(x + c)^2)/x </span>
<span>= (x(x + c) - x^2)/(x(x + c)^2) </span>
<span>= (x^2 + cx - x^2)/(x(x + c)^2) </span>
<span>= cx/(x(x + c)^2) </span>
<span>= c/(x + c)^2 </span>
<span>which proves the equality. </span>