1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margaret [11]
3 years ago
8

Which of the following are not egg laying vertebrates

Biology
1 answer:
swat323 years ago
5 0

Answer:

Therians do not lay egg.all birds lay egg

Explanation:

You might be interested in
What quantity is a measurement of energy used? A 15 liters B 6 joules C 60 milligrams or D 24 meters per second?
Tanzania [10]

B. 6 joules as it is a unit of energy

6 0
3 years ago
A marine biologist has dredged up an unknown animal from the seafloor. Describe some of the characteristics that could be used t
jeka57 [31]

Answer:

The first thing to look at would be type of symmetry the organism exhibits. If it is asymmetrical then it would be a sponge and the discovery could stop right there. If not, other characteristics need to be investigated.

Knowing the type of body cavity this organism has would be helpful.

It would also be beneficial to know what type of skeleton (endo or exo) this organism has and what its appendages look like.

Finally, the type of digestive tract and the presence or absence of a head would help to determine what this creature is.

4 0
2 years ago
Which line is the endpoint of a ray
bixtya [17]

Answer:

A ray is a part of a line that has one endpoint and goes on infinitely in only one direction. You cannot measure the length of a ray. A ray is named using its endpoint first, and then any other point on the ray

Explanation:

6 0
2 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Recall the types of rook in which most caves tend to form.
murzikaleks [220]

Answer:

limestone

Explanation:

3 0
3 years ago
Other questions:
  • What is the relationship between the chemical reaction for photosynthesis and the chemical reaction for respiration
    12·1 answer
  • A segment of dna that codes for the ability to make one type of protein molecule is known as a(n)
    7·2 answers
  • Which phase of a cell's life cycle is occurring when the chromatids are pulled apart and move to the opposite ends of the cell?
    10·2 answers
  • What polysaccharide provides rigidity and strength in plants? Brainliest and 10 points Glycogen Starch Cellulose Chitin
    13·1 answer
  • Why is DNA more accurate than examining physical traits in determining evolutionary relationships? Is there any case in which ph
    5·2 answers
  • In this food pyramid, about __________ of the available energy is transferred to each level.
    6·2 answers
  • brainly!!! can someone help me turn this into an if then statement for my lab??? i am really stuck and can include more info abo
    8·1 answer
  • How do you transcribe dna to mrna to rna
    15·1 answer
  • Will give brainliest!! Make a claim for how the cell cycle relates to the growth and maintenance of organisms. Discuss the stage
    11·1 answer
  • Complete the following vocabulary exercise related to the process of translation of mRNA to protein by the ribosome.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!