1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ycow [4]
3 years ago
14

The plants in level 1 of a food pyramid obtain 30,000 units of energy from the Sun. How much energy is available for the organis

ms in level 2? Level 3?
Biology
1 answer:
Stels [109]3 years ago
4 0

Answer:

level 2 = 3,000  level 3=300

Explanation:

Only 10 percent will be transferred to the next level and 10 percent of 30,000 is 3,000. 10 percent of 3000 is 300

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What happens if a cell is damaged but does not initiate apoptosis?
inysia [295]

Answer:

e

Explanation:

6 0
3 years ago
Read 2 more answers
What factor makes the Hawaiian Islands the perfect place for plant species to diversify?
forsale [732]

Answer:

Climate

Water Supply

Resources

Explanation:

Answer in my own words:

The weather offers a large amount of water and warm temperatures. This services have all the essential tools to sustain plant life or the plant health.

Key words:

1: Sustain

2: Essential

<em><u>Hope this helps.</u></em>

7 0
3 years ago
Read 2 more answers
Two harmful effect of weevils in crop production​
jolli1 [7]

Answer: The main function of the rostrum is to bore holes in plants. In these holes, the female lays her eggs. The eggs hatch into larvae, which eat the plant material surrounding them. If this material is a crop plant or seeds used for human food, the weevils may cause serious damage.

<h2><u><em>Hopethis helps</em></u><em>!!</em> <u><em>Stay safe and healthy</em></u><em>!!</em></h2>

7 0
3 years ago
How does the cell membrane in the diagram above help to maintain the health of this cell?
Morgarella [4.7K]

The<em> cell membrane</em> controls the movement of substances in and out of cells and organelles. In this way, it is selectively permeable to ions and organic molecules.

3 0
3 years ago
Other questions:
  • The _______ functions as both an endocrine and exocrine organ.     
    15·1 answer
  • Most animal bites are puncture wounds true or false
    13·1 answer
  • What properties of life sammy were mentioned
    15·1 answer
  • A pedigree is not helpful to a counselor in predicting the probability of a recessive gene being present and the chances for an
    11·1 answer
  • The ara operon is an inducible operon that controls the production of the sugar arabinose. When arabinose is present in a bacter
    8·2 answers
  • Plzzz....someone ....Diffusion
    12·1 answer
  • Describe a similarity and a difference between meiosis I and meiosis II
    8·1 answer
  • What do humans do to decrease carbon in geosphere and biosphere
    13·1 answer
  • How are the land form pictured above being changed?
    13·2 answers
  • following a meal, glucose must move from the gut lumen, where there is a high glucose concentration, through membrane proteins a
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!