1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DIA [1.3K]
3 years ago
12

What is A gas that is released into the air and soil during the process of breathing and decomposition

Biology
1 answer:
enyata [817]3 years ago
8 0
Carbon dioxide is the correct answer
You might be interested in
In genetic engineering, the staggered cuts in dna that allow genes to be spliced together are made by __________.
AleksandrR [38]

The answer is restriction enzymes. These staggered ends are important in recombination of DNA since they allow DNA strands with complementary sticky ends to be easily joined into one piece by DNA ligase. Other restriction enzymes produce blunt ends. These are harder to join by DNA ligase. An example of a restriction ezyme if EcoRI






5 0
3 years ago
Defined as variation of life on earth, ____________ is the number and relative abundance of different ____________
liberstina [14]

Defined as variation of life on Earth, biodiversity is the number and relative abundance of different species


Biodiversity is determined as the number of different species and the variation of their genetic material. If the number of species is high, then the biodiversity is also high. Area with high/rich biodiversity should be protected since it was home to many species. Using it for economical reason could lead to extinction of many creature.

6 0
3 years ago
Why do saturated fatty acids have straight structures, while unsaturated fatty acids have bent structures?​
rusak2 [61]

Answer:

Saturated fatty acids exhibit a linear structure while unsaturated fatty acids bend, or kink, due to double bonds within the chemical foundation.

Please mark for brainliest.

8 0
3 years ago
Read 2 more answers
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Which biomolecule do mitochondria break down in our body?
Novosadov [1.4K]

Answer:

acetyl CoA

Explanation:

Pyruvate and fatty acids enter the mitochondrion (bottom) and are broken down to acetyl CoA.

3 0
3 years ago
Other questions:
  • PLEASE HELP
    11·2 answers
  • Why do living things need water? (1 point) Living things need water to make food. Living things need water because it is the mos
    7·2 answers
  • What is the greatest issue facing society that results from the development of new applications of cell technology?
    6·2 answers
  • What cells are the outcomes of meiosis? Are these cells diploid or haploid?
    14·1 answer
  • 2. Sketch the inside of the bean nodule, and describe or label what you observed with the hand lens.
    15·1 answer
  • The pedigree diagram shows how a recessive trait is inherited in a family. The red circle shows a person with the trait.​
    9·2 answers
  • What organisms can be found in a pond or a creek?
    5·1 answer
  • How do the functions of the osteoclasts and osteoblasts differ?.
    14·1 answer
  • Which of the following is an example of
    13·1 answer
  • Why being heterozygous for sickle cell anemia in an area with high malaria rates is most beneficial when compared to homozygous
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!