1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergejj [24]
3 years ago
13

What technologies could the state use to lessen its flood risk?

Biology
2 answers:
Liono4ka [1.6K]3 years ago
6 0

Explanation:

they include floodwalls/seawalls, floodgates,levees, and evacuation routes. Nonstructural measures reduce damage by removing people and property out of risk areas. They include elevated structures, property buyout, permanent relocation, zoning, subdivision, and building

klio [65]3 years ago
6 0

Answer:

My state could help prepare for future floods by using weather-detection technologies and building canals to divert overflowing rivers.

Explanation:

You might be interested in
Which of these is an example of an extinction that has been witnessed by humans?
lions [1.4K]

Answer:

Dodo bird...................

7 0
3 years ago
What organelles folds protiens ??
nasty-shy [4]
Endoplasmic Reticulum (ER). This folded membrane forms sacs to store proteins or other substances. It creates a vast surface area where the manufacture of proteins and new membranes can take place. <span>Endoplasmic reticulum is a folded mass of membranes made of the same phospholipids found in the plasma membrane. There are two types of ER smooth (without ribosomes) and rough (with ribosomes)<span>
</span></span>
5 0
3 years ago
Which is not an accurate classification of the python<br>A. Invasive<br>B. Native<br>C. Introduced
lara31 [8.8K]

Answer:

B!

Explanation: hope this helps

7 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
When bacteria are inoculated into a new sterile nutrient broth, their numbers don’t begin to increase immediately. Instead, ther
Delicious77 [7]

Answer: First, the bacteria will adjust and then it will divide.

Explanation:

Once the bacterial species is put into the cultural medium, there the bacteria present in the medium needs to acclimatize in the medium and then start growing.

There is a lag phase before the log phase because first the bacteria will adjust into the medium and then start dividing.

As we know that the growing medium contains amino acids, growth factors, enzymes and many more things which first needs to be utilized by the bacteria and then it will start dividing.

5 0
3 years ago
Other questions:
  • Order the taxa from largest (first) to smallest (eighth).
    12·1 answer
  • Choose all the answers that apply.
    14·2 answers
  • What is the full definition of adaptation?
    7·2 answers
  • What class does a crocodile belong to?
    15·2 answers
  • __________ helps organisms transport nutrients.<br> a. soil<br> b. sap<br> c. water<br> d. wind
    5·1 answer
  • What are the genotypes of these flies?
    12·1 answer
  • What is a seedling answer the question​
    14·2 answers
  • Is the following true or false? Ascomycetes make up the largest phylum in the kingdom fungi.
    10·2 answers
  • After throwing a basketball through the net, Anna observed the ball as it hit the
    15·2 answers
  • Because they create multiple alleles, mutations can cause
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!