1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oduvanchick [21]
3 years ago
5

24. Which organism would occupy the

Biology
1 answer:
Nadusha1986 [10]3 years ago
6 0

Answer:

The organism to have maximum energy would be the algae since ii will be at the lowest level. so the answer is 'B'.

Explanation:

The pyramid of energy shows the flow of energy from one trophic level to other. The lowest trophic level is occupied by the producers. In this case algae acts as the producer. Krill acts as the primary consumer, followed by leopard seal as the secondary consumer and finally killer whale as the tertiary consumer. The <em>lowest trophic level </em> contains maximum energy.

As we go upwards, only 10% of the energy gets transferred to the next trophic level.

You might be interested in
Which of these organisms needs care from its parents after birth? A. frog B. turtle C. mouse D. snake
Alexandra [31]
The answer is C. Mice are mammals so they need to feed on their mother's milk to survive for a few months. After a while, there mother teaches them how to hunt for food. The other animals like frogs, turtles, and snakes leave their babies to fend for themselves.
3 0
4 years ago
Read 2 more answers
Which of these is an exothermic reaction?
stellarik [79]

I think it might be C because when you are rubbing your hands energy is not released it’s absorbed, cooking an egg the heat from the pan is absorbed by the egg, photosynthesis the plant is taking in energy, and in cellular respiration you release energy

6 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Determine the graph scale
swat32
I ant see the graph scale
5 0
3 years ago
What makes the endoplasmic reticulum rough?​
melomori [17]

Answer:

the assembling of the protein molecules around it makes it appear rough.

Explanation:

i hope this is helping

7 0
2 years ago
Other questions:
  • Two abiotic factors that affect an ecosystem are:
    9·1 answer
  • What substance is a pure substance ?
    13·1 answer
  • Eating local food is often considered a way to "go green" and help the
    11·2 answers
  • Ravi ran 200 metres race in sports day. He feels that his heart was beating faster than usual. a) Why was his heart beating fast
    5·1 answer
  • Why do you think the snapper population changed the way it did?
    8·2 answers
  • While mRNA strands are being created a sequence is sometimes miscopied. What will be the effect of this on the cell?
    13·1 answer
  • Which of the following is not a type of scientific model?
    15·1 answer
  • Which statement describes Newton's first law of motion?
    15·1 answer
  • how does the organization of a cell get destroyed? can you put the answer in simple terms instead of biology terms? maby give a
    14·1 answer
  • A hypothesis that girls have better memory than boys
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!