1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lianna [129]
3 years ago
11

An atom has 8 protons , 8 neutrons , and 8 electrons. what is the charge of the atom?

Biology
1 answer:
xxMikexx [17]3 years ago
4 0
I think its uncharged, but I may be wrong
You might be interested in
Structure X is most likely
topjm [15]

Answer:

vesicle

Explanation:

4 0
2 years ago
Why would cellulose be considered a dietary fiber
Vikki [24]

Answer:

Dietary fiber refers to a group of substances in plant foods which cannot be completely broken down by human digestive enzymes. This includes waxes, lignin and  polysaccharides  such as cellulose and pectin. Originally it was thought that dietary fiber was completely indigestible and did not provide any energy.

Explanation:

5 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
What is the body's most indispensable nutrient?​
Shkiper50 [21]
Water is the body's most indispensable nutrient. Indispensable means the most essential, in this case, it's water.
7 0
3 years ago
How many chromosomes, and which chromosomes, does each of the dughter cells contain
labwork [276]

The question is incomplete. However, if we consider this cell as human cell - the cell contain 23 pairs of chromosomes.

Answer:

Chromosomes consists of the constricted DNA associated with the proteins. Different species has different chromosome number. Two main types of chromosomes are heterochromatin and euchromatin.

The human cells contain the 23 pairs of chromosomes or 46 chromosome. If the cell divides by the process of mitosis than the chromosome number will be same in parent as well as the daughter cell. The daughter cell 23 pairs of chromosomes. If the cell divides by the process of mitosis the cell has 23 chromosome number as the meiosis reduces the chromosome number upto half.

7 0
3 years ago
Other questions:
  • What is the speed of a sound wave with a frequency of 680 hertz and a wavelength of 0.5 meters?
    12·2 answers
  • What does circe predict will occur if odysseus raids the cattle of helios?
    8·1 answer
  • Two species of drosophila have been competing in the lab for a long time. a researcher notes that over the course of time, the c
    13·1 answer
  • Translation of the DNA sequence AAGCTGGGA would result in /9798699/5fdc1d25?utm_source=registration
    6·2 answers
  • Which statement describes the term "heterozygous"? A) The alleles are the same. B) The alleles are different. C) There is no all
    15·1 answer
  • Woolly mammoths were grass-eating mammals that resembled elephants but with heavy coats, large tusks, and small ears that made t
    8·2 answers
  • Identify the organelle where photosynthesis takes place. <br><br> B<br><br> C<br><br> D<br><br> E
    10·1 answer
  • Which sentence describes air pollution?
    10·2 answers
  • Which type of sexual exchange occurs among bacteria in which DNA is carried into a bacterial cell by means of a virus
    9·1 answer
  • Match the following vocabulary words with the correct definitions.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!