Answer:
variations says it all...
The population size of a predator species is directly controlled by the population size of it's prey. If the predator has no prey the population size will go down because they have no food.
Once food is in the small intestine, it stimulates the pancreas to release fluid containing a high concentration of bicarbonate. This fluid neutralizes the highly acidic gastric juice, which would otherwise damage the membrane lining of the intestine, resulting in a duodenal ulcer.
Hope it Helped.
I would go with c because its tells you right in there that the ecosystem help who lives around that area.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
