1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
weqwewe [10]
3 years ago
7

1)What two processes fuel the carbon cycle?

Biology
2 answers:
Paul [167]3 years ago
7 0

Answer:

photosynthesis and cellular respiration

Explanation:

just took the test

never [62]3 years ago
4 0

Answer:

In the natural carbon cycle, there are two main processes which occur: photosynthesis and metabolism. During photosynthesis, plants use carbon dioxide and produce oxygen.

Explanation:

You might be interested in
Diabetes, obesity & metabolism: long-term efficacy and safety comparison of liraglutide, glimepiride and placebo, all in com
dangina [55]
Wertyuiop[]]\asdfghjkl;'zxcvbnm,../1234567890-=
6 0
3 years ago
Energy Released from the cellular respiration of glucose is
qaws [65]

Answer:

During the process of glycolysis in cellular respiration, glucose is oxidized to carbon dioxide and water. Energy released during the reaction is captured by the energy-carrying molecule. To this extent, the Answer is (A)

Explanation:

Brainliest Please

6 0
3 years ago
Read 2 more answers
When an atom loses electrons, it becomes positively charged.
Aleks [24]
Yes ..................................
3 0
3 years ago
How do finches recognize members of their own species? answer key?
expeople1 [14]
Finches recognise individuals of their species based on appearance and songs. More specifically, finches differences in appearance that they can recognise include the body colour, size and shape. Concerning the songs that they sing, they are significant differences between the song that each species sing. 
5 0
3 years ago
Pls help, need answers asap
DochEvi [55]
Hydrophobic heads face the inside while the hydrophilic tails face the outside
3 0
2 years ago
Other questions:
  • Jordan wants to conduct an experiment to see if plant food makes a difference in how well plants grow. He gets 10 pots and plant
    5·2 answers
  • How dna can provide some evidence of evolution?
    8·1 answer
  • Based on the cycle of photosynthesis and cellular respiration, one can say that the ultimate original source of energy for all l
    8·1 answer
  • Which gland secretes growth hormone?
    6·2 answers
  • Which best describes the reticular formation of the brain? it is primarily responsible for learning and emotional experience it
    15·2 answers
  • Qual organela faz proteínas
    5·1 answer
  • One of Mendel's Laws of Inheritance. This law states an organism has two different alleles for a trait and the allele that is ex
    7·2 answers
  • Which of these qualities is common to cancer cells? a. They continue to grow even when surrounded by other cells. b. Their produ
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • HELP it’s easy I’ll give Brainliest
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!