1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nata0808 [166]
3 years ago
12

Plzzzzzzzzzzzzzzzzzzzzzzzzzzz help i only need help with B everything eles i can do my self

Biology
1 answer:
Nina [5.8K]3 years ago
4 0

Answer:

I believe that it is the lettuce.

Explanation:

it is the fist thing in the graph so it is the start/producer of the chain.

You might be interested in
Does anyone else answer questions that say they will make you brainliest and then the person never makes you brainleist -_-
mylen [45]

Answer:

all the time

Explanation:

8 0
3 years ago
Read 2 more answers
Micronutrients are needed for _____.
IrinaK [193]
I think the answer is A
Hope this helps have a good night!
4 0
3 years ago
What effect might many years of low precipitation have on water supply?
elena-14-01-66 [18.8K]
It may diminish the water supply because not as much water is being added.
7 0
3 years ago
A plant uses a gas from the air to make sugar during photosynthesis. This process is part of the..
Anit [1.1K]

Answer:

Plants are autotrophs, which means they produce their own food. They use the process of photosynthesis to transform water, sunlight, and carbon dioxide into oxygen, and simple sugars that the plant uses as fuel.

Explanation:

3 0
3 years ago
If the plasma membrane wasn’t selectively permeable, what would happen to your cells when you took a shower? How would this affe
Zepler [3.9K]

Answer:

i would let youre blood cells be <u>clean</u>

<h3>answer2</h3>

it does noting to effect you

<h3>hear me out</h3>

pls give me brainliest answer pls

3 0
3 years ago
Other questions:
  • An unnatural warming of the atmosphere near earth's surface is called
    7·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A particular star is orange. Another star that is much cooler is expected to be. red white blue green
    9·2 answers
  • I need the order of which has more mass:a proton neutron or electron.In greatest to least.I don't need the numbers tho.Thank you
    8·1 answer
  • In which zone are turbidity currents found? What are these currents, how do they flow, and what causes them?
    6·1 answer
  • Formulate a question that could be answered observing chromosomes of different species of animals
    14·1 answer
  • 19. Occur only in animals and help to assemble microtubules.​
    8·1 answer
  • Repede vâ rog ajutaţima
    9·1 answer
  • A student conducts an experiment to determine how the amount of water given to a plant affects its growth. Which of the followin
    13·1 answer
  • List the function done by living organisms
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!