1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fiesta28 [93]
2 years ago
6

Mr Ackah, a retired teacher had been recording consistent increase of blood pressure for the past five year. what accounted for

the rise in his blood pressure?​
Biology
1 answer:
OleMash [197]2 years ago
8 0

Answer:

Change in the vascular system.

Explanation:

High blood pressure occurs when the arteries in the human body system become rigid thereby making the blood pressure rise.

The cause for this situation particularly in older people is the changes in the vascular system or circulatory system.

This is said to be vasoconstriction which lowers the flow of blood in the circulatory system, thereby causing high blood pressure

Hence, since Mr. Ackah is a retired teacher, it is believed that he is an old man susceptible to changes in the vascular system or vasoconstriction.

You might be interested in
The types types of cells that are shaped like roots are_cells
liubo4ka [24]
They are nerve cells
5 0
3 years ago
Which words in the story help the reader understand the meaning of the word flourish in paragraph 1
Aneli [31]

Answer:

C: Find a way to thrive.

Explanation:

N/A

4 0
2 years ago
What are the functions of the menisci?
const2013 [10]

Answer:

Menisci are the semi-lunar fibrous cartilage of the knee which could be either medial meniscus or radial meniscus. The meniscus in humans is present in the joints of the knee, sternoclavicular joints, wrist and temporomandibular joints.

These menisci play important roles in these joints as they reduce the friction caused by the bones during movement. They also disperse the weight of the body of the humans as they spread the load of the weight of the body to different bones like the femur and tibia.

3 0
3 years ago
1. Many species of field mice can reproduce several times a year and produce
statuscvo [17]
I’m pretty sure it’s A.
4 0
3 years ago
Read 2 more answers
All cells are surrounded by a(n) _____
cluponka [151]
Cell Membrane. Even cells with cell walls have a membrane
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which characteristic is shared by all four cells
    5·1 answer
  • What makes a plant green in the cell?-Alice
    14·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What you would look for to tell whether a cell was prokaryotic or eukaryotic. Be specific.
    6·1 answer
  • The movement of ocean water is caused by several processes. _________ results in the continual circulation of ocean water on a g
    14·2 answers
  • In a force of 12 N is applied to an object with a mass of 2 kg what will be its acceleration
    10·2 answers
  • Why is this experiment invalid?
    5·1 answer
  • Do my diffusion Assignment for 30 pts
    14·2 answers
  • the diagram below is showing the use of a transport protein to move particles across the membrane what type of thransport is thi
    10·1 answer
  • Mutations of the brac1 gene in egg cells lead to breast cancer
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!