1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vaieri [72.5K]
3 years ago
8

During meiosis homologous Chromosomes can exchange DNA in a process known as

Biology
1 answer:
Kisachek [45]3 years ago
3 0

Answer:

crossing over

Explanation:

Crossing over is where homologs can exchange DNA which leads to genetic variation

You might be interested in
What is true about elements and compounds elements contain two or more compounds conpounds contain two or more elements compound
statuscvo [17]

Answer:

Taking into account the concepts presented in chemistry with respect to elements and compounds, it is possible to affirm that the compounds are formed by two or more elements.

Explanation:

Two or more chemical elements have the ability to bind -by forming bonds- to obtain a compound. This occurs randomly in nature.

The bonds between the elements that form a compound must be stable enough to ensure the stability of the molecule. A chemical compound can only be separated into the elements that form it by chemical processes.

The bonds types that form compounds can be:

  • <em>Ionic bond.</em>
  • <em>Covalent bond.</em>
  • <em>Coordinated covalent bond.</em>
  • <em>Metallic bond.</em>

It is necessary to mention that chemical elements are called atoms, and the bonds between them are molecules. The physical and chemical properties of a compound will be different from the properties of the elements that form it.

Learn more:

brainly.com/question/2835401

5 0
3 years ago
The motion of an object is called inertia. What force works against an object in motion, or inertia?
Mademuasel [1]

Answer:

i think it is friction bcs gravity helps an abject move and friction causes it to slow down

Explanation:

5 0
3 years ago
2. Members of this kingdom secrete enzymes into their food then absorb the digested matter
Fudgin [204]

Answer:

Fungi

Explanation:

Fungi are an example of saprotrophs i.e. organisms who live and feed on dead organic matter. Saprotrophic nutrition is described as chemoheterotrophic extracellular digestion. It involves the extracellular release of digestive enzymes on the organic matter. The enzymes break down the organic matter into a simpler form, which is then absorbed by the fungus.

4 0
3 years ago
Water is essential for life. Its special properties make water the single most important molecule in plant life. Which of the fo
Maslowich

Answer:

Because water exhibits cohesive behavior.

Explanation:

Cohesive behavior can be explained as a behavior where molecules are attracted to each other.

And this means that,  water molecules are attracted to each  other because of their cohesive behavior. This makes them to be  attracted to other substances, such as the walls of the xylem of plants.

In this case, it is believed that the water molecules behave this  way because they are polar, that is, there is an electronegativity difference between the bonded atoms. And this enables it to move from the roots to the leaves of the plants.

7 0
3 years ago
a white blood cell ingests then digests a number of bacteria which cell organelles were directly responsible for the digestion o
Ipatiy [6.2K]
Bacteria of white cell
6 0
4 years ago
Other questions:
  • Explain why a changing environment can lead to extinction of a species.
    11·1 answer
  • What is a particle with two or more atoms joined together
    7·1 answer
  • What is an organism that must eat other organisms to obtain energy called?
    14·2 answers
  • Which land structure will most likely be left behind after the glacier melts ?
    5·2 answers
  • Which of he following would be considered a qualitative observation
    5·1 answer
  • Africa is a continent split in half by the equator. Which climate zone is it mostly located in?
    12·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • A pyramid of energy for this ecosystem would look more like the pyramid of what
    12·1 answer
  • Positive reinforcement is used to
    15·1 answer
  • Which of the following is NOT a function of the digestive system?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!