1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LekaFEV [45]
3 years ago
12

These branching neuron processes serve as receptive regions and transmit electrical signals toward the cell body. They are _____

_____.
Biology
1 answer:
Katarina [22]3 years ago
3 0

Answer:

They are known as dendrites

You might be interested in
Describe 3 ways the land/terrain change as we move from Charlotte NC to the coastal plains of North Carolina
Katarina [22]

Answer:

Hilly towards flat.

Higher elevation toward lower elevation.

Clayey to sandy type of soil.

Explanation:

The land of Charlotte NC is hilly whereas coastal plains of North Carolina is flat. Charlotte NC is located at a high elevation while on the other hand, the coastal plains of North Carolina are located at the sea and at lower height. The soil type of Charlotte NC is clay and silt whereas the soil type of coastal plains of North Carolina is sandy due to the presence of sea.

3 0
3 years ago
How are humans impacting biodiversity in ecosystems around the world? Provide two examples to support your claim.
balandron [24]

Answer:

as humans population continues to grow, we're cutting down more trees and occupying more lands to suffice the need of citizens, therefore, decreasing the forest biodiversity. Our plastic bags, as well as wastes, are polluting the ocean and eradicating essential species that are required to sustain a balance ecosystem, therefore, decreasing the biodiversity of the ocean that are required to maintain a balance environment.

4 0
3 years ago
Plant Nutrition and Photosynthesis ​
Ghella [55]

Answer:como

Explanation:

cmefr ut y aversduraos

3 0
2 years ago
Darwin hypothesis that favorable traits spread through a species as
LUCKY_DIMON [66]
C) they are passed onto offspring
All of Darwin's selections are based upon the tenet that they are heritable, which is to say passed from one generation to the next
8 0
3 years ago
What if there is no human remain in the world​
blsea [12.9K]

Answer:

the world will end on few hours............

5 0
3 years ago
Read 2 more answers
Other questions:
  • What planet has no moon and hardly any atmosphere
    15·2 answers
  • The hormone epinephrine (adrenaline) increases the pumping rate of the sodium-potassium exchange pump in skeletal muscles. how w
    5·1 answer
  • What evidence supports the idea that h. habilis was an ancestor of h. erectus?
    6·1 answer
  • What is one reason people used to think that nothing could live deep down in the ocean?
    7·1 answer
  • Describe two types of phloem cells that make up phloem tissue and outline how their structure
    5·1 answer
  • Which is involved in refraction? A. colors B. shadows C. speed of light D. absorption of light
    9·1 answer
  • Which of the following countries currently contributes the most lumber to the international market?
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Why do you think coastal cities tend to be cooler than inland cities?
    10·1 answer
  • destruction of the myelin sheath of axons caused by the presence of autoantibody is characteristic of which disease?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!