1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korvikt [17]
3 years ago
11

What process takes place when water or wind loses the force necessary to keep sediments suspended?

Biology
1 answer:
Scrat [10]3 years ago
4 0
I would think deposition
You might be interested in
What is the role of cytoplasm in a living cell?
Law Incorporation [45]
Cytoplasm is a jello like substance that hold all the cells organelles in place|

Imaging a fruit cup with jello in it,the fruits in the cup represent organelles and the jello in the cup represents cytoplasm.
6 0
3 years ago
In a population fulfilling all the assumptions of the Hardy-Weinburg equilibrium, allelic frequencies:
Rzqust [24]

Answer:

A. will not change from generation to generation.  

Explanation:

For a population in the Hardy-Weinberg equilibrium, allele frequencies do not change from generation to generation and remain constant. This occurs when:

-The population is large enough.

-Individuals of the population exhibit random mating .

-No evolutionary force (natural selection, mutation, gene flow, etc.) is operative on the population.

Under these conditions, the allele frequencies of the population are not changed and the population is said to be in "Hardy-Weinberg equilibrium".  

3 0
2 years ago
Name two nutrients that plants need.
artcher [175]

Answer:

Sunlight and water.

Explanation:

The sun is the plant's most important nutrient. Plants convert sunlight into sugars in order to grow. Water is needed in two ways, it serves as both a solvent for mineral salts that are carried inside plant cells, and it is an essential component of photosynthesis. The questioner might have asked "name one" so they don't have enough information to answer with any greater certainty - but the answer remains the same regardless of how many nutrients they ask about.

Minerals are also required by plants in order to function properly including calcium, potassium, iron, magnesium just to name a few minerals which are found in healthy nutritious produce!

5 0
2 years ago
Read 2 more answers
At higher elevations, the boiling point of water decreases, due to the decrease in atmospheric pressure. As a result, what could
marissa [1.9K]

Answer:

Bismuth strontium calcium copper oxide/ACM114901610 can be provided in Alfa Chemistry. We are dedicated to provide our customers the best products and services.

Explanation:

https://www.alfa-chemistry.com/bismuth-strontium-calcium-copper-oxide-cas-114901-61-0-item-195753.htm

8 0
3 years ago
Read 2 more answers
The United States Department of Agriculture has reported a 34% loss in honeybees each year from 2007 to 2010. What are possible
Pachacha [2.7K]

One reason of decline in honeybees is destruction of habitat with pesticide and global warming this decline in plants has had a direct impact to the decline of honeybees.  

4 0
2 years ago
Other questions:
  • This characteristic allows organisms to blend in with their environment.
    15·1 answer
  • Based on the information in the graph, which region's population has grown the least in the last 20 years
    8·2 answers
  • Which statement best explains how exposition helps a playwright develop social issues in a play?
    11·1 answer
  • Which climate zone recieves the highest isolation?
    8·1 answer
  • Which is the most likely outcome of an increased climate temperature?
    6·1 answer
  • What are the 7 terms / groups used in Taxonomic Nomenclature?
    5·1 answer
  • Colorblindness is caused by a recessive x-linked gene. a woman that is heterozygous for this trait marries a man with normal col
    6·1 answer
  • If people from Georgia have just experienced an extremely cold winter the last couple of months, what would the
    7·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What was the invasive species on Christmas Island that changed the ecosystem?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!