Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
I’d say B is the best choice
Hope this helps
-AaronWiseIsBae
Answer:
The first two fingers may be stronger due to the fact that they are used the most often and could build up more strength and dexterity. Another reason the first two fingers may be stronger could be due to the fact that the ulnar muscle that controls digits 4 and 5 is smaller than the radial muscle.
Explanation:
Pinch strength is a widely used measurement of hand function. A direct relationship between pinch strength and function has been demonstrated and illustrates the importance of hand strength in clinical practice.There is a difference in grip strength in the dominant and non-dominant hands.Dominant hand is significantly stronger. According to the pinch strength data, he index finger and the thumb are the strongest, the middle finger and the thumb are the second strongest, the ring finger and the thumb are the third strongest, and the little finger and the thumb are last. The difference is the largest between the middle finger and the thumb and the ring finger and the thumb.
The first two fingers may be stronger due to the fact that they are used the most often and could build up more strength and dexterity. Another reason the first two fingers may be stronger could be due to the fact that the ulnar muscle that controls digits 4 and 5 is smaller than the radial muscle.
Difference in the pinch strength may be due to one possible reason that the radial muscle is larger than the ulnar muscle which controls digits 4 and 5. Another reason could be that you generally use the thumb, index, and middle fingers more than the ring and little finger, therefore the first three fingers have more strength and muscle memory.
Answer:
Second Question:
If a doctor prescribes antibiotics, its because the you have developed a bacterial infetcion on top of your flu or HIV for example.
Explanation:
