1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
My name is Ann [436]
3 years ago
15

If a scientist were to study the organisms in your ecosystem, what questions might they ask? Propose two questions. Think about

the organisms that live in an ecosystem and what things about them might be interesting to study.
Biology
1 answer:
lara [203]3 years ago
4 0
What are high level factors that you would need to measure to inspect improvement in a functioning ecosystem? are drastic climate changes more crucial to an ecosystem than a change in magnitude?
You might be interested in
Need help on checking my answers! The ones circled in yellow are the ones that I believe the answers are. Please and thank you
nirvana33 [79]

This is cyclic change because the population is consistently going up and back down.

8 0
3 years ago
Consider the phylogeny below. The coelom evolved once in the common ancestor of protostomes and deuterostomes. What does the phy
VikaD [51]

Answer:

Flat worms belong to Phylum- Platyhelminthes as they have flat body because they don't have any coelom in their body or called acoelomate

Explanation:

Coelom is called as the true body cavity that is found in Porifera and Cnidaria but when it comes to platyhelminthes, the coelom is not found and thus they have flat like structure and they are categorized under first triploblastic  animals that is they contain 3 tissue layer which are found in higher animals (Ectoderm, Mesoderm and endoderm) also cephalization takes place in this parasitic group which indicates evolution towards higher, complex organisms.

7 0
3 years ago
Question
cricket20 [7]

Answer:

substitution

Explanation:

c replaces g. does not cause a frameshift mutation so it is not insertion or deletion, and i have no clue what corruption is when there is the word "replace" it is probably substitution.

8 0
3 years ago
Read 2 more answers
Do you think fracking is harmful or helpful explain why was two reasons
LenaWriter [7]

I think its harmful, because its unhealthy for workers and its harmful to the environment and to the people. Its also a waste of water and it pollutes the air.

hope that i helped and sorry if i was too late.

3 0
3 years ago
Antibiotics exploit differences in structure between prokaryotes and eukaryotes in order to selectively attack pathogenic bacter
eimsori [14]
<h2>Peptidoglycan Cell Wall </h2>

Explanation:

  • <u>A cell wall containing peptidoglycan and distinctive ribosomes</u>
  • Bacterial cell dividers are made of <em>peptidoglycan</em> (additionally called murein), which is produced using<em> polysaccharide chains cross-connected by irregular peptides containing D-amino acids</em>
  • Gram-positive microscopic organisms have a thick cell divider containing numerous layers of <em>peptidoglycan and teichoic acids</em>
  • <em>Ribosomes are small particles</em> which is related proteins that capacity to synthesize proteins and comprising of RNA
  • Proteins are needed for many cellular capacities, for example, directing chemical procedures and repairing damage
  • Ribosomes can be discovered drifting inside the appended to the endoplasmic reticulum or cytoplasm
4 0
3 years ago
Other questions:
  • The Focus Figure of Synovial Joints has examined a number of types of movement and the joints in which they are located. Review
    7·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Red/green color blindness in humans is caused by an X-linked recessive allele. If a male who is affected by the condition mates
    10·1 answer
  • HELP ASAP!! DUE TOMORROW!! WILL MARK AS BRAINLIEST IF ANSWERED NOW!!
    12·1 answer
  • Where did dogs come from?
    11·1 answer
  • Toxic agents that can cross through the placenta and compromise an unborn child's development are known as ________. teratogens
    15·1 answer
  • The peppered moth is often used as an example of natural selection. Most of the original moths had lighter wings, but as the soo
    7·2 answers
  • How do temperature, sunlight, and salinity (all abiotic factors) influence life in aquatic ecosystems?
    13·1 answer
  • during a solar eclipse, the sun apears to go either fully or partially dark. Why can solar eclipses only be observed on certain
    11·1 answer
  • This is about environmental systems ​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!