1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tigry1 [53]
3 years ago
11

Explain at least three ways in which a mutation in an individual's DNA could occur, and describe at least 2 effects a mutation c

ould have on an individual's traits
Biology
1 answer:
krek1111 [17]3 years ago
3 0

Answer:

Mutations can occur from the following ways:

1. Errors that occur in DNA replication during cell division

2. Exposure to high-energy electromagnetic radiation

3. Exposure to chemicals mutagens

Effects of mutation include:

1. Genetic disorders

2. Cancers

Explanation:

A mutation is a change or alteration that occurs in the DNA sequence of a cell of an organism. These mutations can be passed on to offsprings of that organism. Mutations can occur from the following ways:

1. Errors that occur in DNA replication during cell division: during the process of cell division, the DNA in cell are copied many times. Some errors result when copying DNA, most of which are corrected during proofreading. However, some changes in the DNA sequence may not be corrected, thus resulting in a mutation.

2. Exposure to high-energy electromagnetic radiation: some types of electromagnetic radiation are ionizing, such as UV rays and X-rays. Prolonged exposure to these ionizing radiation may result in permanent damage to parts of the DNA, thereby resulting in a mutation.

3. Exposure to chemicals mutagens: mutagens are substances which are able to cause mutations. Some common chemical mutagens are alkylating agents such as ethylmethane sulfonate and N-methyl-N-nitrosourea.

Effects of mutation include:

1. Genetic disorders: in genetic disorders, certain normal functioning of the body processes are impaired. For example, hemophilia whereby blood lacks the ability to clot normally resulting in excessive bleeding.

2. Cancers: cancers occur when the cell of the body differentiate and grow abnormally. Various types of cancers include breast cancer, prostrate cancer, blood cancer etc.

You might be interested in
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
4 years ago
How many human chromosomes could fit into a single bacterial cell?
vlabodo [156]
The answer is: None
7 0
3 years ago
Conserving the quality of available water is a high priority world-wide. There are many countries whose water supply is reaching
S_A_V [24]
I believe the answer is b
3 0
3 years ago
Read 2 more answers
Which of the following statements regarding the digestive system is correct?
NISA [10]
<span>B. wherever mechanical digestion occurs, chemical digestion also occurs</span>
8 0
3 years ago
Where in the body does pancreatic lipase hydrolyze triglycerides
Ivahew [28]

Answer:

The correct answer is "upper small intestine".

Explanation:

Human digestion involve multiple stages that start in the mouth and go trough different organs, including the stomach and the intestine. The pancreatic lipase plays an important role in digestion by breaking lipids into fatty acids and glycerol. Pancreatic lipase hydrolyze triglycerides in the upper small intestine, completing the job that was started by gastric lipase where complete lipids started to be digested.

6 0
3 years ago
Other questions:
  • The best primary evidence of early saharan history consists of
    13·1 answer
  • What is one product of photosynthesis is one ____ of sugar
    5·1 answer
  • Which material would best be carried in solution by a stream?
    15·1 answer
  • What is vertical feeding pattern
    8·1 answer
  • Why is differential success among organisms with different variants of a trait necessary for natural selection?
    6·1 answer
  • What is multicellular organismss
    12·2 answers
  • The diagram below represents levels of organization in living things. Which term would best represent X?
    11·1 answer
  • TIME REMAINING 01:39:44 Green plants need light in order to survive. Structures in the leaves absorb light, which in turn, helps
    8·2 answers
  • How are the processes of evaporation and condensation similar? Both evaporation and condensation –
    8·1 answer
  • Data and Observations:
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!