1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sati [7]
3 years ago
14

When cutting a stem, you can cut straight across, not at an angle * True False

Biology
2 answers:
Anettt [7]3 years ago
5 0
True I believe because if an angel the stem will not produce the same
ale4655 [162]3 years ago
5 0
That’s a good question
“Hey Siri, can you cut a stem across?”
“Sorry I didn’t get that”
The answer is “sorry, I didn’t get that.”
You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
_____ exhibit two radial body forms, the polyp and the medusa, and use stinging cells to capture prey.
Kryger [21]

The complete statement is this: CNIDARIA exhibit two radial body forms, the polyp and the medusa, and use stinging cells to capture prey.

Cnidaria is categorized under the Animalia kingdom. It is made up of more that eleven thousand species, which all live in aquatic habitats; either fresh or salt water environments. There are four basic classes of cnidarians, these are: Anthozoa, Cubozoa, Scyphozoan and Hydrozoa. Their common feature is the cnidocytes, which are specialized cells that they use to capture their preys.  

Cnidaria have two radial body types, which are called polyp and medusa. They used cnidocytes (stinging cells) to capture the foods they feed on.

3 0
4 years ago
In the late 1980s and early 1990s, the percentage of Icelandic children whose bacterial infections were caused by bacteria resis
Nadya [2.5K]

Answer:

The correct answer would be - "bacterial populations evolve in response to the selection pressure imposed by antibiotics".

Explanation:

The given information provided in the question about the bacterial infection supports the hypothesis that the bacterial population shows the evolution in response to the selection pressure caused by the antibiotics due to the fact that bacteria increased resistance gradually with time. This resistance towards antibiotics increased the percentage of bacterially infected children in the late 1980s and early 1990s.

In this case, the population of bacteria having resistance genes is selected to evolved selected to increase their offsprings.

5 0
3 years ago
Which type of tissue performs the role of signal conduction in the body? A. Connective tissue B. Epithelial tissue C. Muscle tis
Lyrx [107]
The answer is d., nervous tissue that promotes movement in the muscle tissue, triggers the brain on what muscle tissue needs to move, as in walking or lifting weights...

6 0
3 years ago
Which of these is an example of weather?
Flauer [41]

Answer:

Today's chance is what I was taught

8 0
3 years ago
Other questions:
  • The small pieces of rock plus plant and animal pieces are called?
    6·2 answers
  • you find a plant unfamiliar to you and observe that it has vascular bundles scattered throughout the stem cross section. what do
    6·1 answer
  • Low iodide status during the first trimester of pregnancy may lead to
    5·1 answer
  • The gradient of stream depends on
    6·1 answer
  • What is the relative movement of the plate along San Andreas fault
    9·1 answer
  • What are the two types of anaerobic respiration? Describe the two in one paragraph.
    13·2 answers
  • Which is the correct order the steps of the Cell Cycle:
    6·2 answers
  • What are the adaptive features of animal in rainforest
    13·1 answer
  • A small loop of DNA that can get transferred from one bacterium to another bacterium is called a: A. Nucleus B. Plasmid C. mRNA
    7·1 answer
  • Help me pleaseeeeeeeeeeeeeeeeeeeee​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!