1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikklg [1K]
3 years ago
11

A water pump moves 135 liters of water in 15 minutes. How many liters of water is being pumped per minute?​

Mathematics
2 answers:
katrin2010 [14]3 years ago
8 0

Answer:

9 liters of water being pumped per minute

Step-by-step explanation:

In order to find out how many liters of water are being pumped per minute, we need to divide 135 by 15 to get our answer.

135/15 is 9, therefore, 9 liters of water being pumped per minute

rodikova [14]3 years ago
6 0

Answer:

9 liters / minute

Step-by-step explanation:

Take the total amount of water and divide by the number of minutes

135 liters/ 15 minutes

9 liters / minute

You might be interested in
Need help, 40 points.
Greeley [361]

Answer:

m∠1 = 94°

m∠2 = 43°

m∠3 = 50°

m∠4 = 50°

m∠5 = 130°

m∠6 = 130°

Step-by-step explanation:

6 0
3 years ago
Read 2 more answers
If you place a 29-foot ladder against the top of a building and the bottom of the ladder is 24 feet from the bottom of the build
kobusy [5.1K]

Answer:

16.3

Step-by-step explanation:

3 0
3 years ago
PLEASE HELP ASAP! WHOEVER GETS MY QUESTION RIGHT GETS BRAINLIEST! 70 POINTS!!!! Koji is installing a rectangular window in an of
svp [43]

Since we have the length and width of the window, we can multiply the two values.

Convert both fractions to improper fractions

(26/3)*(23/4)

=598/12 ft squared

= This simplifies to 49 5/6 ft. squared

7 0
4 years ago
Read 2 more answers
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
Question 3 options:<br><br> A<br><br><br> B<br><br><br> C<br><br><br> D
Nuetrik [128]

Answer:

b

Step-by-step explanation:

because the line is very long and adding up

8 0
3 years ago
Other questions:
  • Gabriela is building a brick wall. Each row of bricks is 6.5 cm tall except that the top row is 1 cm shorter because it has no m
    7·2 answers
  • A triangle has side lengths of 6,8, and 9 what type of triangle is it
    13·1 answer
  • What’s the value of x
    7·1 answer
  • mikes rents a car for a total of £445 the rental charges are £145 for first day and £60 per day after that for how many days did
    15·1 answer
  • If f(x) = 5x – 2 and g(x) = 2x+1, find (f+ g)(x).
    8·1 answer
  • If 15% of a container of milk is white milk what is the fraction of the remaining chocolate milk
    5·1 answer
  • What is the GCF of 2x4 and 4x2<br> a) 2x^2. B) 2x^4. C) 4x^2
    14·1 answer
  • 4(3y – 6) = -3(8 – 4y)
    14·1 answer
  • HELP PLS MY TEACHER WANTS TO KNOW THE ANSWER!!!
    6·1 answer
  • If x= -2, and y=3, then what is the value of<br> x^3y+ xy3?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!