The constant turnover of body tissues requires the <u>chemical energy </u>supplied by carbohydrates, proteins, and lipids.
<h3> What is Chemical energy?</h3>
- The bonds of chemical molecules contain energy.
- Exothermic reactions are those in which chemical energy is released during the reaction, frequently in the form of heat.
- Some of the heat energy needed for a reaction to continue can be stored as chemical energy in newly created bonds.
- The body transforms the chemical energy in food into heat and mechanical energy.
- At a power plant, coal's chemical energy is transformed into electrical energy. Through the process of electrolysis, the chemical energy in a battery can also generate electricity.
Learn more about chemical energy here:
brainly.com/app/ask?q=CHEMICAL+ENERGY%2BVERIFIED+ANSWERS
#SPJ4
Answer:
Don't ever blame yourself for their decisions your just keep your head up and look at the positive things
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Are tobacco, sun exposure and radiation exposure