1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana66690 [7]
2 years ago
10

HELP! What type of transport does not require energy to move molecules across the plasma membrane?

Biology
2 answers:
svet-max [94.6K]2 years ago
7 0

Answer:

Bilayer

Explanation:

IDK

GrogVix [38]2 years ago
6 0
Passive is the answer.
Because Passive transport can easily be described as transport of atoms, molecules or ions across the cell membrane without requiring energy. The capability of a system towards growing in entropy is the reason that passive transport does not require any cellular energy, unlike the active transport. The permeability of the cell membrane depicts the rate of transfer of molecules, ions or atoms by passive transport, into and out of the cell.
You might be interested in
What’s a example of extrusive rock that cooled to quickly for grains to form
Ket [755]

the answer is a basalt rock.

3 0
3 years ago
10. Lichens are among the first organisms to
lara [203]

Answer:

The correct option is H) these acids change the environment.

Explanation:

Soil can be described as the part of the environment where plants grow. In primary succession, life stars arising in an area which has no soil and only rocks, This is possible because lichens are the organisms which can grow on the rocks. Lichens secrete certain acids which break down these rocks and hence soil begins to form when these rocks break. This makes it possible for other plant species to grow on these lands.

8 0
2 years ago
Which of these is a provisioning service— a benefit that is obtained directly from the environment?
dsp73

I believe it is either B or A, personally i'm leaning towards B, but at the same time, i don't think that we would be obtaining materials via pollination, so it then causes A to make more sense.

7 0
2 years ago
Read 2 more answers
What part of the project plan that tells another person about what you are doing?
irga5000 [103]

B. Objectives project.

<h2>#Continuar aprendiendo</h2>
3 0
2 years ago
Read 2 more answers
The rest of the group agrees with your conclusion that Dr. Tamm was likely exposed to a membrane uncoupling agent. Uncoupling ag
MArishka [77]

Answer:

No more reactions occurs.

Explanation:

The activity of other metabolic pathways also change in response to the proton which enters mitochondria without passing through ATP synthase because ATP synthase is responsible for the production of ATP molecules from proton. If this ATP is not produced no further reactions occurs in the cell. This ATP is used by the cells in various activities so if the proton does not pass through ATP synthase then no energy in the form of ATP is present for other metabolic pathways of the cells.

6 0
3 years ago
Other questions:
  • Homeostasis is the ability of the body to A) prevent the external environment from changing. B) prevent the internal environment
    15·1 answer
  • Complete the sentence. It is likely that when you seek to define the problem, you will see that ________.
    13·2 answers
  • Which organelle is like the brain of the cell
    10·2 answers
  • Which of these BEST describes a scientific variable?
    14·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which sequence below would result in the production of a protein?
    6·2 answers
  • Ramer wants to find out how pressure affects the force of gravity acting on dust particles in a cloud. Ramer designs an experime
    6·1 answer
  • ¿Por qué es fundamental el mantenimiento de la diversidad genética para la supervivencia de la población?
    10·1 answer
  • Resistance to blood flow is regulated primarily by what blood vessels?
    8·1 answer
  • For any photosynthetic producer, different factors can limit growth. Which are the main factors limiting the growth of...
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!