Amniocentesis or amniotic fluid test or AFT refers to the prenatal diagnosis of chromosomal abnormalities and fetal infections. It is performed after 16 weeks of pregnancy. The fetal DNA from a small amount of cells from the amniotic fluid of the amniotic sac is sampled for genetic abnormalities by inserting a needle and extracting it. The fluid contains cells that are sloughed off by the fetus. They are separated from the amniotic fluid, grown in a culture and then microscopically examined for genetic and chromosomal abnormalities. The test is a reliable indicator of chromosomal abnormalities such as Down’s syndrome, spina bifida, muscular dystrophy, rh diseasetrisomy 13, trisomy 18, fragile X, Tay-Sachs disease, Hunter's syndrome and other metabolic disorders.
The basis of the process of Natural selection is the random mutation: some organisms develop random mutations which increase their chance for survival and they survive more likely than other organisms and reproduce.
So the correct answer is:
A) Through random mutations in DNA, some pests developed a resistance to the pesticide.
Answer:
C is the correct answer
Explanation:
The bubonic plague has reduced the world population from an estimated 475 million to 350–375 million.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
The answer is the second choice: variation, overpopulation, adaptation
