1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vaselesa [24]
3 years ago
15

The cuticle _____.

Biology
1 answer:
svp [43]3 years ago
5 0

Answer:

keeps the plant from losing too much

You might be interested in
Which of the following best describes the way the water will flow through the semipermeable membrane
Anni [7]

Answer:

by osmisis

Explanation:

from region of high water potential to one with low water potential

6 0
3 years ago
In some third world countries "cyanide fishing" for aquarium trade is allowed. Cyanide fishing uses the cyanide to "stun" fish a
jok3333 [9.3K]

<span>It could lead to overfishing, since more fish have to be caught due to the high mortality rate.</span>
5 0
3 years ago
Read 2 more answers
What happens when humans burn fossil fuels
Art [367]
Carbon dioxide is released. Carbon dioxide is a greenhouse gas. (<span>Greenhouse gases trap heat from the sun in the Earth's atmosphere, causing temperatures to become hotter than normal) fossil fuels are non-renewable resources.</span>
6 0
3 years ago
Read 2 more answers
The seeds of flowering plants, angiosperms, have similar parts. The part of the seed that is responsible for protecting the deve
slava [35]

Seeds perform various functions for the plants that generate them, among them the essential function is dispersal to a new location, nourishment of the embryo, and dormancy at the time of inappropriate conditions.  

Seed coat is the part of the seed that protects the seed from temperature-associated, physical, or water destruction, it helps in the protection of developing embryo, and it is the seed coat, which makes sure that the plant seed remains in a dormant state until the circumstances become ideal for the plant embryo to sprout or germinate.  


6 0
3 years ago
In what way does translation change information?
lesya [120]
Answer - A. From a N.A code to an A.A code.

Reason - The DNA sent a instructions aka nucleic acid (code) to make amino acid which is important for our muscles.
5 0
3 years ago
Read 2 more answers
Other questions:
  • The ____________ urethra is a short segment that passes through a reproductive organ. it receives secretions from two ejaculator
    14·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • In what ways do humans impact different ecosystems?
    14·1 answer
  • A fly has two alleles for the color of its eyes. The green allele is recessive, and is represented by q. The blue allele is domi
    14·1 answer
  • The outermost tissue of a tree trunk that is 6 feet in diameter would most likely be
    14·1 answer
  • Bacteria are examples
    9·1 answer
  • A. What is the probability a person admitted to the hospital will suffer a treatment-caused injury due to negligence (to 2 decim
    14·1 answer
  • What is the site of the light-dependent reactions? a thylakoid membrane of the chloroplasts b stroma of the chloroplasts c crist
    12·1 answer
  • PLEASE DO THIS WITH YOUR OWN WORDS 20 POINTS
    14·1 answer
  • What were three major milestones in human evolution?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!