1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blababa [14]
3 years ago
12

Help please...!.....​

Biology
1 answer:
andreev551 [17]3 years ago
6 0

Answer:

C is the answer

please mark me Brainliest

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
The big bang produced an imprint of leftover heat called _____.
Ilia_Sergeevich [38]

Answer:

The big bang produced an imprint of leftover heat called CMB radiation

Explanation:

CMD is short for Cosmic Microwave Background

6 0
3 years ago
Read 2 more answers
I have no idea :) please help !
dsp73
Flowers and pollinating insects are examples of <span>coevolution. </span>
8 0
3 years ago
Read 2 more answers
In this case your body acts as a for homeostasis
lara31 [8.8K]

Explanation:

well idk reaalyy

4 0
4 years ago
Read 2 more answers
Which part of cellular respiration produces the atp molecules
Klio2033 [76]

Glycolysis.

In glycolysis, glucose—a six-carbon sugar—undergoes a series of chemical transformations. In the end, it gets converted into two molecules of pyruvate, a three-carbon organic molecule. In these reactions, ATP is made.

5 0
3 years ago
Read 2 more answers
Other questions:
  • The periodic table is organized by
    13·2 answers
  • jane has a toothache, and her doctor gave her a prescription that states: “paracetamol tabs 200 mg bid po.” what does this presc
    9·2 answers
  • ) when someone applies for their california driver's license, they give _____ to be tested by breath or blood whenever requested
    12·1 answer
  • The circulatory system transports substances throughout the body. The diagram shown summarizes blood flow through the circulator
    12·1 answer
  • Which of the following factors will most likely limit the light-dependent reactions of photosynthesis?
    12·2 answers
  • What is the relationship between depth and pressure
    7·2 answers
  • Plz help!!!!<br> Answer
    14·1 answer
  • Robert Koch is credited with the discovery of mycobacterium tuberculosis in 1876 true or false?​
    13·1 answer
  • Which is a correct statement about mutations?
    14·1 answer
  • the efficiency of aerobic metabolism is greater than that of anaerobic metabolism even though much more energy is released in ae
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!