This is the work of Justin cottle not mine
Infections, radiation, UV light, and so forth causes transformations in microscopic organisms. Yes, transformations can influence plasmids. The capacity of plasmids in microscopic organisms is that hello can give extra qualities that may help the bacterium in the earth.
Human cells spend most of their time in interphase, where they do not divide. In interphase, a cell may grow, obtain and nutrients and metabolize them, read DNA, etc.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
The nucleus
Explanation:
This organelle gives all the info. Without it, the cell will die. It's like a human is alive without a brain.
